Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30837

Stmn3 stathmin-like 3 ( MGI:1277137)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30837 EMAGE:30837 EMAGE:30837 EMAGE:30837 EMAGE:30837
euxassay_000708_13 euxassay_000708_01 euxassay_000708_02 euxassay_000708_03 euxassay_000708_04
EMAGE:30837 EMAGE:30837 EMAGE:30837 EMAGE:30837 EMAGE:30837
euxassay_000708_05 euxassay_000708_06 euxassay_000708_07 euxassay_000708_08 euxassay_000708_09
EMAGE:30837 EMAGE:30837 EMAGE:30837 EMAGE:30837 EMAGE:30837
euxassay_000708_10 euxassay_000708_11 euxassay_000708_12 euxassay_000708_14 euxassay_000708_15
EMAGE:30837 EMAGE:30837 EMAGE:30837 EMAGE:30837 EMAGE:30837
euxassay_000708_16 euxassay_000708_17 euxassay_000708_18 euxassay_000708_19 euxassay_000708_20
EMAGE:30837 EMAGE:30837
euxassay_000708_21 euxassay_000708_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 12 15 16 17 18
facial vii ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 18 19 20 21
vagus x ganglion
strong strong
homogeneousstrong expression: see section 08 17 moderate expression: see section 16 weak expression: see section 09
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 10 11 14 15 16
hindgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
vestibulocochlear viii ganglion vestibular component
strong strong
homogeneousstrong expression: see section 04 05 06 07 17 18 19 20
superior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 06 07 18
vestibulocochlear viii ganglion cochlear component
strong strong
homogeneousstrong expression: see section 06 18
inferior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 06 07 18
retina
moderate moderate
regionalmoderate expression: see section 01 02 03 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3778
Entity Detected:Stmn3, stathmin-like 3 ( MGI:1277137)
Sequence:sense strand is shown

>T3778
TGGCCTCGAGCCAGATTCGGCACGAGGATTTGCTCCTGCTTCTACTCTCAGCCTCACCCGAACACCATCT
ACCAGTATGGAGATATGGAAGTGAAGCAGCTGGATAAGCGGGCCTCTGGCCAGAGCTTCGAGGTCATCCT
CAAGTCTCCTTCTGACCTATCTCCAGAGAGCCCTGTGCTCTCTTCTCCTCCCAAGAGGAAGGATGCTTCC
TTGGAAGAGCTGCAGAAGCGGCTGGAGGCAGCTGAGGAGCGGAGGAAGACTCAGGAGGCTCAGGTGCTGA
AGCAGCTGGCAGAGCGGCGTGAGCATGAACGGGAGGTGCTGCACAAGGCGCTTGAAGAAAACAATAACTT
TAGCCGCCTGGCGGAGGAGAAGCTCAACTACAAGATGGAGCTGAGCAAGGAGATCCGCGAGGCGCACTTG
GCAGCGCTGCGCGAGCGGCTGCGCGAGAAGGAGCTGCACGCTGCTGAGGTGCGCAGGAACAAGGAGCAGC
GGGAGGAAATGTCTGGCTAAGGAGTATTGGACCCAGCGGCGACAAGA
Notes:The probe template was PCR amplified from IMAGE:388906 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:388906 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000708 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS