Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30839

Col4a6 ( MGI:2152695)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30839 EMAGE:30839 EMAGE:30839 EMAGE:30839 EMAGE:30839
euxassay_009999_01 euxassay_009999_02 euxassay_009999_03 euxassay_009999_04 euxassay_009999_05
EMAGE:30839 EMAGE:30839 EMAGE:30839 EMAGE:30839 EMAGE:30839
euxassay_009999_06 euxassay_009999_07 euxassay_009999_08 euxassay_009999_09 euxassay_009999_10
EMAGE:30839 EMAGE:30839 EMAGE:30839 EMAGE:30839 EMAGE:30839
euxassay_009999_11 euxassay_009999_12 euxassay_009999_13 euxassay_009999_14 euxassay_009999_15
EMAGE:30839 EMAGE:30839 EMAGE:30839 EMAGE:30839 EMAGE:30839
euxassay_009999_16 euxassay_009999_17 euxassay_009999_18 euxassay_009999_19 euxassay_009999_20
EMAGE:30839 EMAGE:30839 EMAGE:30839
euxassay_009999_21 euxassay_009999_22 euxassay_009999_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
weak weak
regionalweak expression: see section 04 06 20 21
midbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
humerus
weak weak
regionalweak expression: see section 01 02 23
hindlimb digit 4 mesenchyme
weak weak
regionalweak expression: see section 04 06 20 21
clavicle
moderate moderate
regionalmoderate expression: see section 17 18 19 20 weak expression: see section 04 05 06 07 08 16
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
nose
moderate moderate
regionalmoderate expression: see section 09 10 13 15 16 17 18 weak expression: see section 08 19 20
otic capsule
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 06 07 08 09 15 16
hindlimb digit 3 mesenchyme
weak weak
regionalweak expression: see section 04 06 20 21
tibia
moderate moderate
regionalmoderate expression: see section 01
femur
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 20 21
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14
nasal septum
moderate moderate
regionalmoderate expression: see section 14
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 07 19 weak expression: see section 20 21 22 23
mandible
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 16 17 18 19 20 21 weak expression: see section 10
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 19 weak expression: see section 20 21 22 23
hindlimb digit 1 mesenchyme
weak weak
regionalweak expression: see section 04 06 20 21
vault of skull
moderate moderate
regionalmoderate expression: see section 01 02 03 04 06 weak expression: see section 20 21 22
fibula
moderate moderate
regionalmoderate expression: see section 01
rib
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 17 18 19 20 21 22
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
midgut mesenchyme
moderate moderate
regionalmoderate expression: see section 11 12 13 14
hindlimb digit 2 mesenchyme
weak weak
regionalweak expression: see section 04 06 20 21
urinary system
weak weak
regionalweak expression: see section 03 04 05 06 17 18 19
trunk mesenchyme
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
basioccipital bone
moderate moderate
regionalmoderate expression: see section 03 04 05 19 weak expression: see section 20
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 16 17 18 19
lens
strong strong
regionalstrong expression: see section 01 02
maxilla
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 16 17 18 21 weak expression: see section 10
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31762
Entity Detected:Col4a6, ( MGI:2152695)
Sequence:sense strand is shown

>T31762
GGAGATGAAGGCGTCCAAGGCCAACGTGGCCCTTCTGGAACCCCTGGCCTCCCATCATTAACAGGTCTTC
CAGGTGCCCTAGGGCCTCAGGGATTTCCTGGCCTGAAAGGAGACCAAGGAAACTCAGGACGTACCACCTT
TGGAGAAGCTGGCCTACCTGGCAGGGTTGGTTTACCAGGTTTACCAGGCCTGCCAGGCCCATCAGGCCCA
CCTGGTCGCACATTTGAGACTGGACATCTGTCCAACATAGAGCCTGGGTTCCCTGGTCTCCAAGGAGAAC
AAGGTCCAAAAGGACATCAAGGCCTCAAAGGAGTAAAAGGAGACTCTGGTTTTTGTGCTTGTGAAGGTGG
TGCCCCCAACATTGGACCACATGGGGAACCAGGTCTGCCTGGGATACAAGGTCCCATTGGTCTACAGGGT
TTTAAGGGGACTAAAGGAGATCCAGGCTCAAGGGGAGCATCTGGTCCTGCAGGGACGCCAGGGCTATTTG
GACCTAGAGGTCAGACTGGCCTCAAAGGAAAGAAAGGAGAACCAACTGTCAGTAGAGGATCAAAAATGTC
AGGGGACAAAGGTGACCCTGGTCCTCAGGGTACCCCAGGTTTGGCAGGAACTCCGGGCAAGGATGGAAGA
CCAGGTTTACCAGGCCTCCCAGGCATTCAGGGAGATGGTGGGTCTGGCTTCCCAGGTGAAAGAGGGTTAC
CAGGACTTCCTGGTGAAAAAGGCCATGATGGTCCAATTGGACCACCAGGAATTGGGCTGCCAGGACCTCC
TGGGCCCCGTGGACTTCCTGGAGATAAAGGAGTAGATGGGTTACCAGGGCAACAAGGCCTCCGTGGAGCT
CAAGGAGTCACCTTGCCTTGTATCATTCCTGGGTCATATGGTCCATCAGGATTTCCTGGAGCTCCTGGAT
TCCCAGGCTCTAAGGGAGCTCGGGGCCTCCCTGGAATTCCAGGCAAGCCTGGCACTCACGGAAGCAAAGG
AG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3500535), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60113. Forward Primer - name:060113_F_IRAV95_f04_Col4a6, sequence:GGAGATGAAGGCGTCCAA; Reverse Primer - name:060113_R_SP6_IRAV95_f04_Col4a6, sequence:CCTCCTTTGCTTCCGTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009999 same experiment
 EMAGE:30845 same embryo
 EMAGE:30540 same embryo
 EMAGE:30534 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS