Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30849

Gas7 ( MGI:1202388)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849
euxassay_001801_01 euxassay_001801_02 euxassay_001801_03 euxassay_001801_04 euxassay_001801_05
EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849
euxassay_001801_06 euxassay_001801_07 euxassay_001801_08 euxassay_001801_09 euxassay_001801_10
EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849
euxassay_001801_11 euxassay_001801_12 euxassay_001801_13 euxassay_001801_14 euxassay_001801_15
EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849
euxassay_001801_16 euxassay_001801_17 euxassay_001801_18 euxassay_001801_19 euxassay_001801_20
EMAGE:30849 EMAGE:30849 EMAGE:30849 EMAGE:30849
euxassay_001801_21 euxassay_001801_22 euxassay_001801_23 euxassay_001801_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
weak weak
homogeneousweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 24
cerebral cortex mantle layer
weak weak
homogeneousweak expression: see section 04 05 06 07 08 09
telencephalon mantle layer
weak weak
homogeneousweak expression: see section 05 06
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 17 18 19 20
olfactory cortex marginal layer
weak weak
homogeneousweak expression: see section 12 13 14 15 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2650
Entity Detected:Gas7, ( MGI:1202388)
Sequence:sense strand is shown

>T2650
TGGCCTCGAGCCAGATTCGTCACGAGGCCAAGGGCAAAAATCCTCTAAATGCCACTCACATCTTTCAGTC
TCACAATGCACATCACGGATAGCTTACTAATCTTGGACCTTCTGGCAGCCCATCCACAGAACCATCTCTC
ATGGTTGTTAGCAAGATGCCTAACACACTCAAGCAAACTAAGCACTGTCACTTTCCTTTCTGAACCATCT
CAGCCATAAAGGCCACCATGAGGACATCTCACCAACCTGTGCTCAGCATGAACTGTGACACCAGCCTTTG
ATAGTAGGACATTATTTCTTGATTTCCTTATTAAAAGAAAAAAATGGGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1434390 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1434390 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001801 same experiment
 EMAGE:30850 same assay
 EMAGE:29508 same embryo
 EMAGE:30850 same embryo
 EMAGE:29522 same embryo
 EMAGE:29988 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS