Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30887

Vegfc vascular endothelial growth factor C ( MGI:109124)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30887 EMAGE:30887 EMAGE:30887 EMAGE:30887 EMAGE:30887
euxassay_008899_01 euxassay_008899_02 euxassay_008899_03 euxassay_008899_04 euxassay_008899_05
EMAGE:30887 EMAGE:30887 EMAGE:30887 EMAGE:30887 EMAGE:30887
euxassay_008899_06 euxassay_008899_07 euxassay_008899_08 euxassay_008899_09 euxassay_008899_10
EMAGE:30887 EMAGE:30887 EMAGE:30887 EMAGE:30887 EMAGE:30887
euxassay_008899_11 euxassay_008899_12 euxassay_008899_13 euxassay_008899_14 euxassay_008899_15
EMAGE:30887 EMAGE:30887 EMAGE:30887
euxassay_008899_16 euxassay_008899_17 euxassay_008899_18

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cardiovascular system
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
pituitary gland
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12
diencephalon roof plate
strong strong
regionalstrong expression: see section 09
thalamus mantle layer
strong strong
regionalstrong expression: see section 05 06 07 11 12 13
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T270
Entity Detected:Vegfc, vascular endothelial growth factor C ( MGI:109124)
Sequence:sense strand is shown

>T270
CGGACCGGCCTCCCTGCTCCCGGTCCATCCACCATGCACTTGCTGTGCTTCTTGTCTCTGGCGTGTTCCC
TGCTCGCCGCTGCGCTGATCCCCAGTCCGCGCGAGGCGCCCGCCACCGTCGCCGCCTTCGAGTCGGGACT
GGGCTTCTCGGAAGCGGAGCCCGACGGGGGCGAGGTCAAGGCTTTTGAAGGCAAAGACCTGGAGGAGCAG
TTGCGGTCTGTGTCCAGCGTAGATGAGCTGATGTCTGTCCTGTACCCAGACTACTGGAAAATGTACAAGT
GCCAGCTGCGGAAAGGCGGCTGGCAGCAGCCCACCCTCAATACCAGGACAGGGGACAGTGTAAAATTTGC
TGCTGCACATTATAACACAGAGATCCTGAAAAGTATTGATAATGAGTGGAGAAAGACTCAATGCATGCCA
CGTGAGGTGTGTATAGATGTGGGGAAGGAGTTTGGAGCAGCCACAAACACCTTCTTTAAACCTCCATGTG
TGTCCG
Notes:The probe template was PCR amplified from IMAGE:2655127 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2655127 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008899 same experiment
 EMAGE:30008 same embryo
 EMAGE:30021 same embryo
 EMAGE:30871 same embryo
 EMAGE:30781 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS