Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30900

Lmo3 LIM domain only 3 ( MGI:102810)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30900 EMAGE:30900 EMAGE:30900 EMAGE:30900 EMAGE:30900
euxassay_016491_01 euxassay_016491_02 euxassay_016491_03 euxassay_016491_04 euxassay_016491_05
EMAGE:30900 EMAGE:30900 EMAGE:30900 EMAGE:30900 EMAGE:30900
euxassay_016491_06 euxassay_016491_07 euxassay_016491_08 euxassay_016491_09 euxassay_016491_10
EMAGE:30900 EMAGE:30900 EMAGE:30900 EMAGE:30900 EMAGE:30900
euxassay_016491_11 euxassay_016491_12 euxassay_016491_13 euxassay_016491_14 euxassay_016491_15
EMAGE:30900 EMAGE:30900 EMAGE:30900 EMAGE:30900 EMAGE:30900
euxassay_016491_16 euxassay_016491_17 euxassay_016491_18 euxassay_016491_19 euxassay_016491_20
EMAGE:30900 EMAGE:30900 EMAGE:30900
euxassay_016491_21 euxassay_016491_22 euxassay_016491_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 10 11
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 10 11 12
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 23 weak expression: see section 03 04 10 11 21
telencephalon mantle layer
strong strong
regionalstrong expression: see section 07 08 18 19 moderate expression: see section 02 03 04 05 23 weak expression: see section 21 22
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 weak expression: see section 12 13 14 15 16
ventral grey horn
weak weak
regionalweak expression: see section 07 09 10 11 12 13 14
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 15 16 weak expression: see section 13 14
intermediate grey horn
weak weak
regionalweak expression: see section 09
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 15 weak expression: see section 05 09 10 12 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38853
Entity Detected:Lmo3, LIM domain only 3 ( MGI:102810)
Sequence:sense strand is shown

>T38853
CTGAATAGGGTAGCGGTAGGTGAGCAGGATGGCCATGTGGAGGAGAAGGTGGACTGCATCTGTATGTAGT
GAAATTGCCCCCGTTCAAGAGTTGAATGTTCATTATTAAAGAGAGAAGTAATGTATATATTGCTGGATTT
TTTTGCCTGCCATTCGTTTTTTTGTGTCACTTGGCATGAGATGTTTATTTTGGACTATTGTATATAATGT
ATTGTAAATCCAAAGCACAAATGTAATACAGTTTTATTGTGTTACCATTTGTGTTTGGTTTGCTTCTTTG
TATTGTTGCATTTAGTACAATCAGTGTTTCAACTTACTGTACATTTATGCTTTCTGTGTCTGCCAGCTAT
TTTCAGCGAGCTGTACCTTTCTAGTAAGAATTGAAGAGCAAACCTCCACAATGACACACAGATGAAGCAA
GACTATCGACGTTAGAAAGGCAAAAATAAGCAAGTAAACAAACAAAAAAGCAGTTAGTGACATCTGCTTC
TTACGGCTACAACAGCTTGGTGTAGCGCCGCGTTCTTGTCATAACCCCCTATTTTCAGGGGGCTAAAGAT
CAGCTTTAAAAAATGATAACGATTTCAGCTTAAAGCACTTTCGTTTTATGCCAACGTGAAAAGTGCCATT
CTTAAAATGACTTTAAAGCTTAGTGACGTCCTCCAATGTCCTTTACCGAGCTCCTTACCATCACTATTAG
ATTTATTCTACTTTTGTTTTTCCAGCCACACGCCCTATTTGAACTAGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 236142. Forward Primer - name:165297_F_cDNA_Lmo3, sequence:CTGAATAGGGTAGCGGTAGGTG; Reverse Primer - name:165297_N_SP6_cDNA_Lmo3, sequence:CACTAGTTCAAATAGGGCGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016491 same experiment
 EMAGE:30902 same embryo
 EMAGE:30899 same embryo
 EMAGE:30029 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS