Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30902

Tessp3 ( MGI:2684822)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902
euxassay_016497_01 euxassay_016497_02 euxassay_016497_03 euxassay_016497_04 euxassay_016497_05
EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902
euxassay_016497_06 euxassay_016497_07 euxassay_016497_08 euxassay_016497_09 euxassay_016497_10
EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902
euxassay_016497_11 euxassay_016497_12 euxassay_016497_13 euxassay_016497_14 euxassay_016497_15
EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902
euxassay_016497_16 euxassay_016497_17 euxassay_016497_18 euxassay_016497_19 euxassay_016497_20
EMAGE:30902 EMAGE:30902 EMAGE:30902 EMAGE:30902
euxassay_016497_21 euxassay_016497_22 euxassay_016497_23 euxassay_016497_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 23 weak expression: see section 06 07
telencephalon mantle layer
strong strong
regionalstrong expression: see section 08 20 moderate expression: see section 03 04 05 07 23 24
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 weak expression: see section 06 10 11 12 14 15 16
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 08 10 11 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38850
Entity Detected:Tessp3, ( MGI:2684822)
Sequence:sense strand is shown

>T38850
GTACATGGTGATGTTGGGTGACGACATGCTGCATTCTGAATCTGAAAGTGTGACCCTGGTCCCAGTCCAG
GACATCATTTTCCCTTCCAACTTTGACATTCAAACCATGAGGAATGACATTGCCCTTGCTCTGCTGTACT
TCCCCGTGAATTACTCCTCGCTCATCCAGCCCGTGTGCCTTCCCGAAGAGCCCTTCCGAGTGAAAAACGG
GACAGTGTGCTGGGTGACTGGCTGGGGCCAACAGAACGAAATTGATGCAGGGTTTGCATCCATTCTCCTC
CAGGAGGTTCAGCAACGCATTCTCCTCCAGAAGCACTGTAACACGCTGTTCCAGAGACAGCTGGGGACAT
CGAAAAACCTAGTGATTAAAGGGATGATCTGCGGTCTGCAAGACTCAGGACAGAGTCTTTGTTGGGGAGA
TTCTGGGAACCCCCTTGTCTGCGAATCTGACAACACGTGGACCCAGGTGGGGATCATGAGCTGGGGCATC
AACTGCAATGGAGTCCCTGTCCTCTCAGTTTACACAGACATCGCTGAGTACAATGAGTGGGTCAGCTATG
TCTTAAGTCAGGCTTCCCGTATGGATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 236112. Forward Primer - name:165267_F_cDNA_Tessp3, sequence:GTACATGGTGATGTTGGGTGAC; Reverse Primer - name:165267_N_SP6_cDNA_Tessp3, sequence:GATCCATACGGGAAGCCTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016497 same experiment
 EMAGE:30900 same embryo
 EMAGE:30899 same embryo
 EMAGE:30029 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS