Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30930

Fbxl22 F-box and leucine-rich repeat protein 22 ( MGI:1921415)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930
euxassay_000915_01 euxassay_000915_02 euxassay_000915_03 euxassay_000915_04 euxassay_000915_05
EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930
euxassay_000915_06 euxassay_000915_07 euxassay_000915_08 euxassay_000915_09 euxassay_000915_10
EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930
euxassay_000915_11 euxassay_000915_12 euxassay_000915_13 euxassay_000915_14 euxassay_000915_15
EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930
euxassay_000915_16 euxassay_000915_17 euxassay_000915_18 euxassay_000915_19 euxassay_000915_20
EMAGE:30930 EMAGE:30930 EMAGE:30930 EMAGE:30930
euxassay_000915_21 euxassay_000915_22 euxassay_000915_23 euxassay_000915_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 10 11 12 13 14 20 21 22 23 24
alimentary system
moderate moderate
homogeneousmoderate expression: see section 11 12 13 14 15 weak expression: see section 02 03 04 05 06 07 08 09 10 16 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3649
Entity Detected:Fbxl22, F-box and leucine-rich repeat protein 22 ( MGI:1921415)
Sequence:sense strand is shown

>T3649
TGGCCTCGAGCCAGATTCGGACGAGGGAAGCCGGAGGAGCCTCTCCAGGACTTGCTCCCAGCTCCGAGAT
GTGTTTGAGGACCCCACCCTCTGGCCCCTGCTGCACTTCCATTCTCTCGCAGAGCTCAAGAAAGACAACT
TCCGGCTGAGCCCTGCGCTGCGCAGCCTGTCCATCTGTTGGCATTCCAGCCGTGTGCAGGTGTGCAGCAT
CGAGGACTGGCTCAAGAGCGCCCTCCAGAGGAGCATCTGCAGCCAGCACGAGAGCCTGGTTAATGATTTC
CTCCTGCAGGTGTGCAACAGGTGCCCCAACCTGACGTCCGTCACGCTGTCGGGCTGCGGCCACGTCACGG
ACGACTGCCTGGCGCGCTTGCTGCTCAGCTGCCCGCGCCTGCGTACGCTGCGCCTCGAGAACTGCGCGCG
CGTTACCAACCGCACGCTGGCGGCCGTGGCCGCGCACGGGCGCGCGCTGCAGACTCTGCACGTGGACTTC
TGCCGCAACGTGAGCGCCGCCGGCCTGCTCCGCCTCCGCGCCGCCTGCCCGAACCTGCGCC
Notes:The probe template was PCR amplified from IMAGE:348445 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:348445 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000915 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS