Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30936

Uhrf1 ubiquitin-like, containing PHD and RING finger domains, 1 ( MGI:1338889)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936
euxassay_016008_01 euxassay_016008_02 euxassay_016008_03 euxassay_016008_04 euxassay_016008_05
EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936
euxassay_016008_06 euxassay_016008_07 euxassay_016008_08 euxassay_016008_09 euxassay_016008_10
EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936
euxassay_016008_11 euxassay_016008_12 euxassay_016008_13 euxassay_016008_14 euxassay_016008_15
EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936
euxassay_016008_16 euxassay_016008_17 euxassay_016008_18 euxassay_016008_19 euxassay_016008_20
EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936 EMAGE:30936
euxassay_016008_21 euxassay_016008_22 euxassay_016008_23 euxassay_016008_24 euxassay_016008_25
EMAGE:30936
euxassay_016008_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 25
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 21 weak expression: see section 19 20
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 25
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 09 10 21 22 23 weak expression: see section 07 08 11 12 16 17 18 19 20
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 09 10 21 23 weak expression: see section 07 08 11 12 19 20
bladder
weak weak
regionalweak expression: see section 13 14 15 16
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 19
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 25 26
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 19 weak expression: see section 20
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 25 26
thymus primordium
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 17 weak expression: see section 15 16
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 18 19 20 21
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23 24 25
midbrain ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 07 08 09 10 12 14 15 16 17 18
hindgut
moderate moderate
regionalmoderate expression: see section 14 15
neural retina
moderate moderate
regionalmoderate expression: see section 01 24 25 26 weak expression: see section 02 03 04 22 23
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 15 16 weak expression: see section 11 14
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 25 26
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 09 10 11 weak expression: see section 25 26
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15
thyroid gland
weak weak
regionalweak expression: see section 12 13 17
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 18 19 moderate expression: see section 10 11 17 20
vomeronasal organ
weak weak
regionalweak expression: see section 12 14
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 11 12 14 15
liver lobe
moderate moderate
regionalmoderate expression: see section 03 05 06 07 09 10 11 12 13 14 15 17 18 19 20 21 22 23 weak expression: see section 01 02 04 08 16 24 25 26
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 15 16 weak expression: see section 14
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15 weak expression: see section 12
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 weak expression: see section 16 24 25
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39643
Entity Detected:Uhrf1, ubiquitin-like, containing PHD and RING finger domains, 1 ( MGI:1338889)
Sequence:sense strand is shown

>T39643
GAAGGAGAACAAGAAGAAGGCAAAGATGGCATCAGCCACTTCCTCCTCCCAGCGGGACTGGGGTAAGGGC
ATGGCATGTGTGGGCCGCACCACAGAGTGTACCATTGTGCCCGCCAACCACTTTGGGCCCATCCCTGGTG
TCCCTGTGGGCACCATGTGGCACTTCAGAGTCCAGGTCAGTGAGTCCGGTGTGCATCGGCCTCATGTGGC
AGGCATCCATGGCCGGAGCAACGACGGTGCCTACTCATTGGTCCTGGCTGGTGGCTATGAGAATGATGTG
GACAATGGCAATTACTTCACATACACAGGGAGTGGTGGCCGAGACCTCTCTGGCAACAAGCGTACAGCAG
GCCAGTCCTCTGACCAGAAGCTCACTAATAACAATAGGGCTCTGGCACTCAATTGCCACTCCCCAATCAA
TGAGAAAGGTGCGGAGGCTGAAGACTGGCGCCAAGGGAAGCCAGTGTGTGTGGTCCGGAACATGAAGGGC
GGGAAACACAGCAAGTACGCTCCCGCAGAGGGCAACCGCTATGATGGCATCTACAAGGTGGTGAAGTACT
GGCCAGAGAGAGGGAAATCTGGCTTCCTCATGTGGCATTATCTCCTTCGACGAGATGACACAGAGCCTGA
GCCCTGGACCCGAAAGGGCAAGGACCGCACTCGACAGCTGGGGCTCACTATGCAGTACCCTGAAGGCTAC
TTGGAGGCCTTGGCTAACAAGGAGAAGAGCAGGAAGCGCCCGGCCAAGGCCTTGGAGCAGGGACCCTCAT
CTTCCAAGACAGGCAAAAGCAAACAGAAATCCACAGGGCCAACCCTCTCCAGCCCCCGTGCCTCTAAGAA
TAGCAAGCTGGAGCCATACACACTCTCAGAGCAGCAGGCTAACCTCATCAAAGAGGACAAGGGCAAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86821. Forward Primer - name:086821_F_cDNA_LOC277860, sequence:GAAGGAGAACAAGAAGAAGGCA; Reverse Primer - name:086821_N_SP6_cDNA_LOC277860, sequence:GTTGCCCTTGTCCTCTTTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016008 same experiment
 EMAGE:30937 same assay
 EMAGE:30043 same embryo
 EMAGE:30041 same embryo
 EMAGE:30937 same embryo
 EMAGE:31257 same embryo
 EMAGE:30046 same embryo
 EMAGE:30931 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS