Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30958

Foxp4 forkhead box P4 ( MGI:1921373)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30958 EMAGE:30958 EMAGE:30958 EMAGE:30958 EMAGE:30958
euxassay_001657_01 euxassay_001657_02 euxassay_001657_03 euxassay_001657_04 euxassay_001657_05
EMAGE:30958 EMAGE:30958 EMAGE:30958 EMAGE:30958 EMAGE:30958
euxassay_001657_06 euxassay_001657_07 euxassay_001657_08 euxassay_001657_09 euxassay_001657_10
EMAGE:30958 EMAGE:30958 EMAGE:30958 EMAGE:30958 EMAGE:30958
euxassay_001657_11 euxassay_001657_12 euxassay_001657_13 euxassay_001657_14 euxassay_001657_15
EMAGE:30958 EMAGE:30958 EMAGE:30958 EMAGE:30958 EMAGE:30958
euxassay_001657_16 euxassay_001657_17 euxassay_001657_18 euxassay_001657_19 euxassay_001657_20
EMAGE:30958 EMAGE:30958
euxassay_001657_21 euxassay_001657_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
strong strong
regionalstrong expression: see section 17 18
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 13 14 15 16 17 18 19 weak expression: see section 11 12
hindlimb digit 1 mesenchyme
strong strong
regionalstrong expression: see section 18 19
stomach
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 02 03 04 07 08
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 17 18 19
rib
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 20
axial skeleton
moderate moderate
regionalmoderate expression: see section 07 08 09 10 13 14 weak expression: see section 11 12
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09
viscerocranium
moderate moderate
regionalmoderate expression: see section 03 04 05 06 09 13 14 15 16 17
hindlimb digit 2 mesenchyme
strong strong
regionalstrong expression: see section 17 18 19
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 12 13 14 15 16 17 18 19 20
basioccipital bone
moderate moderate
regionalmoderate expression: see section 05 06 07 09 13 14 15 16 17 18
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
hindlimb digit 3 mesenchyme
strong strong
regionalstrong expression: see section 17 18 19
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 11 12 13 14 15 16 17 18
not examined not examined
regionalnot examined expression: see section 06 07 08 09
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 15 16 17 18
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4007
Entity Detected:Foxp4, forkhead box P4 ( MGI:1921373)
Sequence:sense strand is shown

>T4007
TGGCCTCGAGGCCAGATTCGATCCTTGGATCCAGCTGGCCAAGGAGAGTGAGCGGCTGCAGGCCATGATG
GCACATCTGCACATGCGGCCTTCAGAGCCCAAGCCCTTCAGCCAGCCAGTGACCGTCTCCGCAGACCCGT
TCCCGGATGGCCTCGTGCACCCCCCAACTTCAGCCGCTGCCCCCGTCACACCCCTGCGTCCCCCTGGCCT
GGGCTCTGCCTCTTTGCACAGTGGGGGCCCTGCCCGCAGGAGAAGTAATGACAAATTCTGCTCCCCCATC
TCCTCAGAGCTTGCCCAGAATCATGAGTTCTACAAGAACGCTGACGTCAGGCCCCCCTTCACCTACGCTT
CCCTTATCCGCCAGGCCATTCTGGAAACTCCAGATCGGCAGCTGACGCTAAATGAGATTTATAACTGGTT
CACCAGGATGTTCGCCTACTTCCGAAGAAACACGGCCACCTGGAAGAATGCCGTGCGCCACAACCTCAGC
CTGCACAAGTGTTTCGTCCGTGTGGAGAACGTCAAGGGGGCCGTGTGGACTGTGGATGAGCGGGAATATC
AGAAACGGAGACCGCC
Notes:The probe template was PCR amplified from IMAGE:1152368 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1152368 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_001657 same experiment
 EMAGE:29281 same embryo
 EMAGE:29283 same embryo
 EMAGE:29277 same embryo
 EMAGE:30464 same embryo
 EMAGE:30446 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS