Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30964

Atp6v1c1 ATPase, H+ transporting, lysosomal V1 subunit C1 ( MGI:1913585)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30964 EMAGE:30964 EMAGE:30964 EMAGE:30964 EMAGE:30964
euxassay_002745_01 euxassay_002745_02 euxassay_002745_03 euxassay_002745_04 euxassay_002745_05
EMAGE:30964 EMAGE:30964 EMAGE:30964 EMAGE:30964 EMAGE:30964
euxassay_002745_06 euxassay_002745_07 euxassay_002745_08 euxassay_002745_09 euxassay_002745_10
EMAGE:30964 EMAGE:30964 EMAGE:30964 EMAGE:30964 EMAGE:30964
euxassay_002745_11 euxassay_002745_12 euxassay_002745_13 euxassay_002745_14 euxassay_002745_15
EMAGE:30964 EMAGE:30964
euxassay_002745_16 euxassay_002745_17

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 10 11 12
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 13 14 15
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 11
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 11 12 13 14 15 16
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T980
Entity Detected:Atp6v1c1, ATPase, H+ transporting, lysosomal V1 subunit C1 ( MGI:1913585)
Sequence:sense strand is shown

>T980
TCGAGNCTGTTGGCCTACTGGACTTGCTCTGGGCGCAGGGGTCGAGGAAGCCGAAAGGCCGGAGCTTAGG
TCCGGGAGGGATGGAGCGCTGAGCGGTTAACGTCTACCAGGCTTCCTGCCTCCGCACCTGTCGCCGCCGC
CGCCTCCTGAGACACCTCGGCTTCTCCCTTGCTTGCCAAAGAGGTAACAAACATGACTGAGTTCTGGCTC
ATATCTGCTCCTGGGGAGAAAACCTGTCAGCAAACATGGGAGAAACTACATGCAGCGACCACCAAGAACA
ATAATCTTGCCGTCTCTTCCAAGTTCAACATTCCTGACCTAAAGGTTGGCACGTTGGATGTCTTGGTTGG
CTTGTCGGATGAACTGGCTAAACTGGATGCATTTGTAGAAGGTGTGGTCAAGAAAGTGGCTCAGTACATG
GCTGATGTGCTGGAGGACAGCAAAGATAAAGTTCAGGAGAACTTGCTGGCCAGCGGAGTTGACTTGGTTA
CTTACATAACAAGGTTCCAGTGGGATATGGCTAAATATCCAATCAAGCAGTCTCTGAAAAATATTT
Notes:The probe template was PCR amplified from IMAGE:1972366 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1972366 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002745 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS