Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30973

Sult1d1 ( MGI:1926341)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973
euxassay_009138_01 euxassay_009138_02 euxassay_009138_03 euxassay_009138_04 euxassay_009138_05
EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973
euxassay_009138_06 euxassay_009138_07 euxassay_009138_08 euxassay_009138_09 euxassay_009138_10
EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973
euxassay_009138_11 euxassay_009138_12 euxassay_009138_13 euxassay_009138_14 euxassay_009138_15
EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973
euxassay_009138_16 euxassay_009138_17 euxassay_009138_18 euxassay_009138_19 euxassay_009138_20
EMAGE:30973 EMAGE:30973 EMAGE:30973 EMAGE:30973
euxassay_009138_21 euxassay_009138_22 euxassay_009138_23 euxassay_009138_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 10
kidney calyx
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19
stomach pyloric region
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12
midgut
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 06 07 08
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1217
Entity Detected:Sult1d1, ( MGI:1926341)
Sequence:sense strand is shown

>T1217
TCCTCNAGNCTGTTGGCCTACTGGAAGCTTACCACAACTTAATTTCTTTCTCACATTACGTTGTGAGCTA
CCCAGGGACATCATCCTTTTAAAGACTTTTCGGTTCTGATTCTTCATCTGAGAAAACTCATTTAAAGCTC
CGAGAATTTAAAGTCTCCCCAAATGGATAACAAACTGGATGTCTTCAGGAGGGAGTTAGTGGATGTTGAA
GGTATCCCTCTCTTTTGGAGCATTGCTGAGCATTGGTCCCAAGTAGAGTCATTTGAAGCCCGGCCTGATG
ACATTTTGATCTCCACATATCCCAAATCTGGAACAACTTGGGTCAGTGAAATACTGGATTTGATCTACAA
CAATGGGGATGCAGAGAAATGTAAAAGGGATGCAATCTACAAACGAGTACCATTCATGGAGCTTATAATT
CCTGGGATAACAAATGGAGTTGAAATGCTGAACAACATGCCGTCTCCTCGAATAGTGAAAACACACCTTC
CTGTTCAGCTGCTTCCTTCCTCATTCTGGAAAAATGACTGCAAGATTATTTATGTGGCACGGAATGCCAA
AGATGTGGTTGTTTCT
Notes:The probe template was PCR amplified from IMAGE:2192416 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2192416 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009138 same experiment
 EMAGE:29329 same embryo
 EMAGE:31037 same embryo
 EMAGE:29310 same embryo
 EMAGE:29416 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS