Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30981

Plod1 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 ( MGI:99907)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981
euxassay_002758_01 euxassay_002758_02 euxassay_002758_03 euxassay_002758_04 euxassay_002758_05
EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981
euxassay_002758_06 euxassay_002758_07 euxassay_002758_08 euxassay_002758_09 euxassay_002758_10
EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981
euxassay_002758_11 euxassay_002758_12 euxassay_002758_13 euxassay_002758_14 euxassay_002758_15
EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981
euxassay_002758_16 euxassay_002758_17 euxassay_002758_18 euxassay_002758_19 euxassay_002758_20
EMAGE:30981 EMAGE:30981 EMAGE:30981 EMAGE:30981
euxassay_002758_21 euxassay_002758_22 euxassay_002758_23 euxassay_002758_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
axial skeleton lumbar region
strong strong
regionalstrong expression: see section 11 12
thoracic intervertebral disc
strong strong
regionalstrong expression: see section 13 14 15 16 17
axial skeleton thoracic region
strong strong
regionalstrong expression: see section 12
lumbar intervertebral disc
strong strong
regionalstrong expression: see section 13 14 15 16
humerus
moderate moderate
regionalmoderate expression: see section 04 05 06 22 23 24 not examined expression: see section 08
clavicle
moderate moderate
regionalmoderate expression: see section 08 10 11 18 19
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
axial skeleton
strong strong
regionalstrong expression: see section 11
axial skeleton sacral region
strong strong
regionalstrong expression: see section 11 12 13 14 15
axial skeleton tail region
strong strong
regionalstrong expression: see section 13 14
foot mesenchyme
weak weak
regionalweak expression: see section 02 03 04 22 23 24
nose
strong strong
regionalstrong expression: see section 11 12 18 19 20 21 moderate expression: see section 08 09 10
otic capsule
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 18 19 20 21 22 23 24
trachea
moderate moderate
regionalmoderate expression: see section 14 15
hand mesenchyme
weak weak
regionalweak expression: see section 02 03
cervical intervertebral disc
strong strong
regionalstrong expression: see section 13 14 15 16 17
femur
moderate moderate
regionalmoderate expression: see section 06 07 08 18 19 20
sacral vertebral cartilage condensation
strong strong
regionalstrong expression: see section 16
nasal septum
strong strong
regionalstrong expression: see section 13 14 15 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2300
Entity Detected:Plod1, procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 ( MGI:99907)
Sequence:sense strand is shown

>T2300
TGGCCTCGAGCCAGATCGGATCCTTGGGTGGACGAGCTGGTGGAGGAGATGGAACACTATGGCCAGTGGT
CTCTGGGTGATAATAAGGACAACCGGATCCAGGGTGGCTACGAAAACGTGCCCACTATCGACATCCATAT
GAACCAGATCACCTTCGAGCGGGAGTGGCACAAGTTCCTGGTGGAGTATATCGCCCCCATGACAGAGAAG
CTGTACCCTGGCTACTACACTAGGGCCCAGTTTGATCTAGCCTTTGTCGTCCGCTATAAGCCTGATGAGC
AGCCTTCCTTGATGCCCCACCATGACGCCTCTACCTTCACCGTCAACATAGCCCTGAACAGGGTTGGGGA
AGATTATGAGGGCGGAGGTTGCCGATTTCTGCGCTACAACTGCTCCGTGAGGGCACCAAGGAAGGGCTGG
GCCCTCCTGCACCCCGGGCGGCTCACACACTATCATGAGGGGCTTCCTACTACCAAGGGCACGCGCTACA
TTGCTGTGTCTTTCGTCGATCCCTAACTGCCCAGTGCCTGCCTCTGTTCGACCTATCTCATCGTTGACAA
CCAC
Notes:The probe template was PCR amplified from IMAGE:1122946 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1122946 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002758 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS