Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30993

Dlk1 delta-like 1 homolog (Drosophila) ( MGI:94900)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993
euxassay_012302_01 euxassay_012302_02 euxassay_012302_03 euxassay_012302_04 euxassay_012302_05
EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993
euxassay_012302_06 euxassay_012302_07 euxassay_012302_08 euxassay_012302_09 euxassay_012302_10
EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993
euxassay_012302_11 euxassay_012302_12 euxassay_012302_13 euxassay_012302_14 euxassay_012302_15
EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993
euxassay_012302_16 euxassay_012302_17 euxassay_012302_18 euxassay_012302_19 euxassay_012302_20
EMAGE:30993 EMAGE:30993 EMAGE:30993 EMAGE:30993
euxassay_012302_21 euxassay_012302_22 euxassay_012302_23 euxassay_012302_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
strong strong
regionalstrong expression: see section 10 11 12 13 14
pituitary gland
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
mesenchyme
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 24
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 13
axial skeleton
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
axial skeleton tail region
strong strong
regionalstrong expression: see section 12 13 14
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 15 16 17 18
pons mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 14 15 16 17 18 19
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 13 14 15 16
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 17 18
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 13
midbrain ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 12 14 15 17 19 20 21 moderate expression: see section 22
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 17 18
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30444
Entity Detected:Dlk1, delta-like 1 homolog (Drosophila) ( MGI:94900)
Sequence:sense strand is shown

>T30444
GCATCTGCAAGGATGGCTGGGACGGGAAATTCTGCGAAATAGACGTTCGGGCTTGCACCTCAACCCCCTG
CGCCAACAATGGAACTTGCGTGGACCTGGAGAAAGGCCAGTACGAATGCTCCTGCACACCTGGGTTCTCT
GGAAAGGACTGCCAGCACAAGGCTGGGCCCTGCGTGATCAATGGTTCTCCCTGCCAGCACGGAGGCGCCT
GCGTGGATGATGAGGGCCAGGCCTCGCATGCTTCCTGCCTGTGCCCCCCTGGCTTCTCAGGCAACTTCTG
TGAGATCGTAGCCGCAACCAACAGCTGTACCCCTAACCCATGCGAGAACGATGGCGTCTGCACCGACATC
GGGGGTGACTTCCGTTGCCGCTGCCCAGCTGGATTCGTCGACAAGACCTGCAGCCGCCCGGTGAGCAACT
GCGCCAGTGGCCCGTGCCAGAACGGGGGCACCTGCCTCCAGCACACCCAGGTGAGCTTCGAGTGTCTGTG
CAAGCCCCCGTTCATGGGTCCCACGTGCGCGAAGAAGCGCGGGGCTAGCCCCGTGCAGGTCACCCACCTG
CCCAGCGGCTATGGGCTCACCTACCGCCTGACCCCCGGGGTGCACGAGCTGCCTGTTCAGCAGCCCGAGC
AACACATCCTGAAGGTGTCCATGAAAGAGCTCAACAAGAGTACCCCTCTCCTCACCGAGGGACAGGCCAT
CTGCTTCACCATCCTGGGCGTGCTCACCAGCCTGGTGGTGCTGGGCACCGTGGCCATCGTCTTTCTCAAC
AAGTGCGAAACCTGGGTGTCCAACCTGCGCTAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6581768), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58547. Forward Primer - name:058547_F_IRAV105_f08_Dlk1, sequence:GCATCTGCAAGGATGGCT; Reverse Primer - name:058547_R_SP6_IRAV105_f08_Dlk1, sequence:TGTAGCGCAGGTTGGAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012302 same experiment
 EMAGE:29847 same embryo
 EMAGE:30967 same embryo
 EMAGE:29848 same embryo
 EMAGE:29300 same embryo
 EMAGE:29855 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS