Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30998

Ephx1 epoxide hydrolase 1, microsomal ( MGI:95405)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30998 EMAGE:30998 EMAGE:30998 EMAGE:30998 EMAGE:30998
euxassay_002751_01 euxassay_002751_02 euxassay_002751_03 euxassay_002751_04 euxassay_002751_05
EMAGE:30998 EMAGE:30998 EMAGE:30998 EMAGE:30998 EMAGE:30998
euxassay_002751_06 euxassay_002751_07 euxassay_002751_08 euxassay_002751_09 euxassay_002751_10
EMAGE:30998 EMAGE:30998 EMAGE:30998 EMAGE:30998 EMAGE:30998
euxassay_002751_11 euxassay_002751_12 euxassay_002751_13 euxassay_002751_14 euxassay_002751_15
EMAGE:30998 EMAGE:30998
euxassay_002751_16 euxassay_002751_17

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 06 10 11
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 02 03 04 10 11 12
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 04 11
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 01 02 03 11 12 13 14 15 16
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 12
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 09 10 11
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12
axial skeleton
moderate moderate
regionalmoderate expression: see section 08 09 10
4th ventricle lateral recess
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 02 03 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T982
Entity Detected:Ephx1, epoxide hydrolase 1, microsomal ( MGI:95405)
Sequence:sense strand is shown

>T982
TCCTCGAGNCTGTTGGCCTACTGGAAAGAGGCTCAAGAGGAGTTTGAGAGTGGAGGAACTGCACACCAGC
CGCCGCGGGAGTAGGAACCCGAGAGCGACCCTGACAGAGTCATGTGGCTGGAACTCATCCTGGCTTCTGT
GCTGGGCTTTGTCATCTACTGGTTTGTCTCCCGGGACAAGGAGGAGACCTTACCACTTGAAGATGGGTGG
TGGGGCCCAGGGTCAAAGCCATCAGCCAAAGAAGATGAGAGCATCCGGCCCTTCAAGGTGGAAACATCAG
ATGAGGAGATCAAGGACTTGCACCAGAGGATAGATAGGTTCCGGGCATCCCCACCTTTGGAGGGCAGTCG
CTTCCACTATGGCTTCAACTCCAGCTACCTGAAGAAAGTGGTGTCCTTCTGGAGGAATGAGTTTGACTGG
AGGAAGCAGGTGGAGATCCTCAACCAATACCCACACTTTAAGACCAAGATTGAAGGGCTGGACATCCACT
TCATCCACGTGAAACCTCCCCAGCTGCCCTCAGGCCGCACTCCAAAGCC
Notes:The probe template was PCR amplified from IMAGE:1972503 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1972503 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002751 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS