Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:30999

Atp6ap1 ATPase, H+ transporting, lysosomal accessory protein 1 ( MGI:109629)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999
euxassay_000573_01 euxassay_000573_02 euxassay_000573_03 euxassay_000573_04 euxassay_000573_05
EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999
euxassay_000573_06 euxassay_000573_07 euxassay_000573_08 euxassay_000573_09 euxassay_000573_10
EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999
euxassay_000573_11 euxassay_000573_12 euxassay_000573_13 euxassay_000573_14 euxassay_000573_15
EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999
euxassay_000573_16 euxassay_000573_17 euxassay_000573_18 euxassay_000573_19 euxassay_000573_20
EMAGE:30999 EMAGE:30999 EMAGE:30999 EMAGE:30999
euxassay_000573_21 euxassay_000573_22 euxassay_000573_23 euxassay_000573_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 06 07 08 09 10 14 15 16 17
facial vii ganglion
weak weak
homogeneousweak expression: see section 17 18 19 23
vagus x ganglion
weak weak
homogeneousweak expression: see section 15
trigeminal v ganglion
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 15 16 17 18 19 20 23
vestibulocochlear viii ganglion
weak weak
homogeneousweak expression: see section 16 17
glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 01 05 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2237
Entity Detected:Atp6ap1, ATPase, H+ transporting, lysosomal accessory protein 1 ( MGI:109629)
Sequence:sense strand is shown

>T2237
GGCCTCNAGCCAGATTCGGATCCTTGATCACCAGCGATATGCAGCTTTCTACCTACTTAGACCCTGCCCT
GGAGCTGGGTCCCCGTAATGTACTGCTGTTCCTACAGGACAAGCTAAGCATTGAGGATTTCACAGCATAC
GGTGGTGTGTTTGGAAATAAGCAGGACAGTGCCTTTTCTAACCTGGAGAATGCCCTGGACTTGGCCCCCT
CCTCACTGGTGCTTCCTGCTGTGGACTGGTATGCAATCAGCACTCTGACCACCTACCTACAGGAGAAGCT
TGGGGCTAGCCCCTTGCATGTGGATCTAGCTACCTTAAAGGAGCTGAAGCTCAATGCCAGCCTTCCTGCC
CTGCTGCTCATCCGTCTGCCCTACACAGCCAGCTCCGGTCTGATGGCGCCCAGGGAGGTCCTCACAGGTA
ACGATGAGGTCATCGGACAGGTACTGAGCACACTCAAGTCTGAAGATGTCCCTTACACCGCAGCTCTTAC
TGCAGTCCGCCCTTCTAGAGTGGCCCGTGATATAACCATGGTGGCTGGGGGTCTAGGTCGCCAGCTGCTT
CAGACTCAGGTGGCA
Notes:The probe template was PCR amplified from IMAGE:1050498 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1050498 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000573 same experiment
 EMAGE:30107 same embryo
 EMAGE:30415 same embryo
 EMAGE:30085 same embryo
 EMAGE:30187 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS