Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31003

4921524J17Rik ( MGI:1913964)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003
euxassay_000571_01 euxassay_000571_02 euxassay_000571_03 euxassay_000571_04 euxassay_000571_05
EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003
euxassay_000571_06 euxassay_000571_07 euxassay_000571_08 euxassay_000571_09 euxassay_000571_10
EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003
euxassay_000571_11 euxassay_000571_12 euxassay_000571_13 euxassay_000571_14 euxassay_000571_15
EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003
euxassay_000571_16 euxassay_000571_17 euxassay_000571_18 euxassay_000571_19 euxassay_000571_20
EMAGE:31003 EMAGE:31003 EMAGE:31003 EMAGE:31003
euxassay_000571_21 euxassay_000571_22 euxassay_000571_23 euxassay_000571_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
esophagus
moderate moderate
regionalmoderate expression: see section 12
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 04 05 06 08 09 16 17 18 weak expression: see section 19 20 21 22 23
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 04 05 06 08 09 10 12 13 14 16 17 20 21 22 24 weak expression: see section 02 03 07 18 23
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 04 05 06 08 09 10 17 18 19 20 21 22 weak expression: see section 03 07 23
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 12 13 14 weak expression: see section 15
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 08 09 10 14 16 17 18 20 21 22 weak expression: see section 03 07
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14
axial skeleton
moderate moderate
regionalmoderate expression: see section 10 12 13 14 17
nose
weak weak
regionalweak expression: see section 08 09 10 12 13 14 15 16 17 18 19 20
otic capsule
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 22 24 weak expression: see section 03 04 05 06 16 17 18 19 20 21 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1763
Entity Detected:4921524J17Rik, ( MGI:1913964)
Sequence:sense strand is shown

>T1763
AATGACCAGAAAAGCCCCGGAACCTGGATGGGTCTTTCCCGATTGGAGGGACAGGAGTACGGGTGGAACA
CACAGCTGGAGCAGCTGACGTGCTTGCTAGTTTTCAGGTTCGCACCAGAGATGCAGTGTCTTAAGTCCTG
TCAGGAGAGTGACTTTTAAATGTATGTATTTCAGGCTTTCACCATTAACAGATTGCATATATACAATCCA
TTGACTTTTAATAAATTGGTAATTGATATTTTATTGAATGGAGAATTACGAATATAGATTATAAATTCTG
TCTTTAATTGACCTTTTTCTTGGGCGCTATTTTAATGATTTAAGTAGGAGTTATATTTT
Notes:The probe template was PCR amplified from IMAGE:483649 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:483649 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000571 same experiment
 EMAGE:32185 same embryo
 EMAGE:32184 same embryo
 EMAGE:30399 same embryo
 EMAGE:30578 same embryo
 EMAGE:30983 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS