Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31024

Cacna2d3 ( MGI:1338890)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31024 EMAGE:31024 EMAGE:31024 EMAGE:31024 EMAGE:31024
euxassay_009353_01 euxassay_009353_02 euxassay_009353_03 euxassay_009353_04 euxassay_009353_05
EMAGE:31024 EMAGE:31024 EMAGE:31024 EMAGE:31024 EMAGE:31024
euxassay_009353_06 euxassay_009353_07 euxassay_009353_08 euxassay_009353_09 euxassay_009353_10
EMAGE:31024 EMAGE:31024 EMAGE:31024 EMAGE:31024 EMAGE:31024
euxassay_009353_11 euxassay_009353_12 euxassay_009353_13 euxassay_009353_14 euxassay_009353_15
EMAGE:31024 EMAGE:31024 EMAGE:31024 EMAGE:31024 EMAGE:31024
euxassay_009353_16 euxassay_009353_17 euxassay_009353_18 euxassay_009353_19 euxassay_009353_20
EMAGE:31024 EMAGE:31024
euxassay_009353_21 euxassay_009353_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 weak expression: see section 04
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 17 18 weak expression: see section 02
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 16 17 18 19 20 weak expression: see section 02
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 weak expression: see section 21 22
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 04
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 weak expression: see section 04
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 weak expression: see section 03 04
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35116
Entity Detected:Cacna2d3, ( MGI:1338890)
Sequence:sense strand is shown

>T35116
GCCTCCATGACTTAGAACATCCTGACGTGTCCTTGGCAGATGAATGGTCCTACTGCAACACTGACCTGCA
CCCAGAGCACCGCCATCTATCTCAACTGGAAGCCATTAAGCTCTACCTCAAAGGCAAGGAGCCTCTGCTT
CAATGTGACAAAGAATTGATTCAAGAAGTCCTTTTTGATGCTGTGGTGAGCGCCCCTATTGAAGCCTATT
GGACGAGCCTGGCCCTCAACAAATCTGAGAATTCTGACAAGGGTGTAGAGGTCGCCTTCCTCGGCACTCG
CACAGGCCTCTCAAGAATCAACCTGTTTGTGGGGGCCGAACAACTCACCAATCAGGACTTTCTGAAGGCT
GGAGACAAAGAGAACATTTTTAATGCCGATCATTTCCCTCTCTGGTACAGAAGAGCTGCCGAGCAGATCG
CAGGAAGCTTTGTCTATTCCATCCCCTTCAGCACAGGAACAGTCAACAAAAGCAATGTGGTGACAGCAAG
TACCTCCATCCAGCTCCTGGATGAGCGGAAATCTCCCGTGGTGGCAGCTGTAGGCATTCAGATGAAACTT
GAATTCTTCCAAAGGAAGTTCTGGACTGCCAGCAGACAGTGTGCCTCCCTGGATGGCAAATGCTCCATAA
GCTGCGATGACGAGACTGTGAACTGTTACCTTATAGACAATAACGGATTCATTCTGGTGTCTGAAGACTA
CACACAGACTGGAGATTTTTTTGGTGAGGTGGAAGGAGCTGTCATGAACAAGTTGTTAACAATGGGTTCC
TTTAAAAGAATAACCTTGTACGACTACCAAGCCATGTGTAGAGCCAACAAGGAGAGCAGTGACAGTGCCC
ATGGACTTCTGGACCCCTATAAGGCCTTTCTCTCTGCAGCCAAGTGGATAATGACGGAACTTGTCTTGTT
CCTGGTGGAGTTTAACCTGTGCAGTTGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98969. Forward Primer - name:098969_F_cDNA_Cacna2d3, sequence:GCCTCCATGACTTAGAACATCC; Reverse Primer - name:098969_N_SP6_cDNA_Cacna2d3, sequence:ACCAACTGCACAGGTTAAACTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009353 same experiment
 EMAGE:30429 same embryo
 EMAGE:29496 same embryo
 EMAGE:29495 same embryo
 EMAGE:31335 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS