Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31047

Snrpa1 small nuclear ribonucleoprotein polypeptide A' ( MGI:1916231)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047
euxassay_002737_01 euxassay_002737_02 euxassay_002737_03 euxassay_002737_04 euxassay_002737_05
EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047
euxassay_002737_06 euxassay_002737_07 euxassay_002737_08 euxassay_002737_09 euxassay_002737_10
EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047
euxassay_002737_11 euxassay_002737_12 euxassay_002737_13 euxassay_002737_14 euxassay_002737_15
EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047
euxassay_002737_16 euxassay_002737_17 euxassay_002737_18 euxassay_002737_19 euxassay_002737_20
EMAGE:31047 EMAGE:31047 EMAGE:31047 EMAGE:31047
euxassay_002737_21 euxassay_002737_22 euxassay_002737_23 euxassay_002737_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 17 18 19
esophagus
strong strong
regionalstrong expression: see section 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 17 18 19 20 weak expression: see section 07 08
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 12 13 14 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 14 15 16 17 18 19
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T904
Entity Detected:Snrpa1, small nuclear ribonucleoprotein polypeptide A' ( MGI:1916231)
Sequence:sense strand is shown

>T904
CCTCNAGNCTGTTGGCCTACTGGACTGTGGGACACGGCACTGGCGGGAGGCGCAGGCTGGTGTCGGAGGT
GAGGGTCCGCGGGCTGCGACAGGATGGTGAAGCTGACGGCGGAGCTGATCGAGCAGGCGGCGCAGTACAC
AAATGCCGTACGGGACCGTGAACTGGACCTCCGGGGATATAAAATTCCGGTTATTGAGAATCTGGGTGCC
ACCTTAGACCAGTTTGATGCTATTGATTTTTCTGACAATGAGATCCGGAAACTGGACGGTTTCCCTTTGT
TGAGAAGACTGAAAACATTATTAGTGAACAACAACAGAATTTGCCGTATAGGTGAGGGACTTGACCAGGC
TCTTCCCTGTCTGACAGAGCTCATCCTCACCAACAACAGTCTAGTGGAACTGGGTGATCTGGACCCGTTG
GCATCTCTCAAATCACTGACATATCTAAGCATCCTAAGAAACCCTGTAACCAATAAGAAGCATTATCGAC
TTTATGTGATTTATAAAGTTCCACAAGTCAGAGTACTGGACTTTCAGAAAGTGAAACTCAAA
Notes:The probe template was PCR amplified from IMAGE:1924594 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1924594 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002737 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS