Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31051

Nav1 neuron navigator 1 ( MGI:2183683)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31051 EMAGE:31051 EMAGE:31051 EMAGE:31051 EMAGE:31051
euxassay_002735_01 euxassay_002735_02 euxassay_002735_03 euxassay_002735_04 euxassay_002735_05
EMAGE:31051 EMAGE:31051 EMAGE:31051 EMAGE:31051 EMAGE:31051
euxassay_002735_06 euxassay_002735_07 euxassay_002735_08 euxassay_002735_09 euxassay_002735_10
EMAGE:31051 EMAGE:31051 EMAGE:31051 EMAGE:31051 EMAGE:31051
euxassay_002735_11 euxassay_002735_12 euxassay_002735_13 euxassay_002735_14 euxassay_002735_15
EMAGE:31051 EMAGE:31051 EMAGE:31051 EMAGE:31051 EMAGE:31051
euxassay_002735_16 euxassay_002735_17 euxassay_002735_18 euxassay_002735_19 euxassay_002735_20
EMAGE:31051 EMAGE:31051
euxassay_002735_21 euxassay_002735_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 22
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 16 17
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 14
forebrain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
spinal cord
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 16 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 14 15 16
cornea stroma
moderate moderate
regionalmoderate expression: see section 21 not examined expression: see section 02 03 04 22
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18 19 20
midbrain
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 not examined expression: see section 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
not examined not examined
regionalnot examined expression: see section 14
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 15 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 15
hindbrain
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2366
Entity Detected:Nav1, neuron navigator 1 ( MGI:2183683)
Sequence:sense strand is shown

>T2366
TGGCCTCGAGCCAGAATTCGGATCCTTGGGTTCTGGACAGAAAGCTGCTTGGGAAGACCCGGTGGAATGG
GTCCGAGACACTCTTCCCTGGCCGTCGGCCCAACAAGACCAATCAAAGCTCTACCACCTGCCCCCGCCTT
CTGTGGGCCCCCACAGCACTGCCTCACCCCCGGAGGACAGGACAGTCAAAGACAGCACTCCAAACTCCCT
CGACTCAGATCCCCTGATGGCCATGCTGCTGAAACTCCAAGAAGCTGCCAACTACATTGAGTCACCAGAT
CGAGAGACTATCCTGGACCCCAACCTCCAGGCGACACTCTGAGGGCCCGGCAGAAGGCTGGCTTCAGCGT
CATTAGCTCTCCTCTGCCCTCTTCCTTCATAGCTCTGGCTCACCAGCCTCGCCAAGAGAACAGGAGGGAA
GAAGAGGGCAGGAGGAGGGATGGGTTCTCGGTGCTGAACCTTTGAGAACTTCCTACTAGGAATTGGAGGG
GGTGGAGTTTGAGAAATCCGTGTCCCTTAAATACATTTGCTGGC
Notes:The probe template was PCR amplified from IMAGE:1180081 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1180081 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002735 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS