EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31069

Smarca2 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 ( MGI:99603)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_000790_01	euxassay_000790_02	euxassay_000790_03	euxassay_000790_04	euxassay_000790_05

euxassay_000790_06	euxassay_000790_07	euxassay_000790_08	euxassay_000790_09	euxassay_000790_10

euxassay_000790_11	euxassay_000790_12	euxassay_000790_13	euxassay_000790_14	euxassay_000790_15

euxassay_000790_16	euxassay_000790_17	euxassay_000790_18	euxassay_000790_19	euxassay_000790_20

euxassay_000790_21	euxassay_000790_22	euxassay_000790_23	euxassay_000790_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Text Annotation:

Structure

Level

Pattern

Notes

cerebral cortex

weak

regional

weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21

Annotation Validation:

text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T3807
Entity Detected:	Smarca2, SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 ( MGI:99603)
Sequence:	sense strand is shown >T3807 TGGCCTCGAGNCAGATTCGGACGAGGCTCAGAGAGGGAAGATTCAGCCAGCACACTGCTCGCGAGCAAGT GTCACTCTGCTAACTGGCAGAGCCAGGAGACCTAGATGTCCACACCCACAGACCCAGCAGCAATGCCCCA TCCTGGGCCCTCCCCGGGGCCTGGACCCTCTCCTGGACCAATTCTGGGGCCTAGTCCAGGACCAGGACCA TCCCCAGGTTCTGTGCACAGCATGATGGGTCCTAGTCCCGGACCTCCCAGCGTCTCACATCCTCTGTCAA CGATGGGCTCTGCAGACTTCCCACAGGAAGGCATGCACCAATTACATAAGCCCATGGATGGGATACATGA CAAAGGGATTGTAGAAGATGTCCACTGTGGATCCATGAAGGGCACCAGCATGCGCCCCCCACACCCAGGA ATGGGCCCTCCACAGAGCCCCATGGACCAGCACAGCCAAGGTTATATGTCACCACATCCGTCTCCTCTGG GAGCCCCGGAGCACGTCTCTAGCCCTATATCTGGAGGAGGCCCAACCCCACCCCAGA
Notes:	The probe template was PCR amplified from IMAGE:403171 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:403171 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_000790 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source