Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31077

Fkbp7 FK506 binding protein 7 ( MGI:1336879)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31077 EMAGE:31077 EMAGE:31077 EMAGE:31077 EMAGE:31077
euxassay_002949_01 euxassay_002949_02 euxassay_002949_03 euxassay_002949_04 euxassay_002949_05
EMAGE:31077 EMAGE:31077 EMAGE:31077 EMAGE:31077 EMAGE:31077
euxassay_002949_06 euxassay_002949_07 euxassay_002949_08 euxassay_002949_09 euxassay_002949_10
EMAGE:31077 EMAGE:31077 EMAGE:31077 EMAGE:31077 EMAGE:31077
euxassay_002949_11 euxassay_002949_12 euxassay_002949_13 euxassay_002949_14 euxassay_002949_15
EMAGE:31077 EMAGE:31077 EMAGE:31077 EMAGE:31077 EMAGE:31077
euxassay_002949_16 euxassay_002949_17 euxassay_002949_18 euxassay_002949_19 euxassay_002949_20
EMAGE:31077 EMAGE:31077 EMAGE:31077
euxassay_002949_21 euxassay_002949_22 euxassay_002949_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
meckel's cartilage
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 18 19 20 moderate expression: see section 03 21 22 23
lower jaw molar
strong strong
regionalstrong expression: see section 05 06 07 08 18 19 20 moderate expression: see section 21 22
upper jaw molar
strong strong
regionalstrong expression: see section 05 06 07 08 18 19 20 moderate expression: see section 21 22
lower jaw incisor
strong strong
regionalstrong expression: see section 10 11 12 13 16 17
upper jaw incisor
strong strong
regionalstrong expression: see section 10 11 12 13 16 17
rib
strong strong
regionalstrong expression: see section 04 05 06 07 08 20 21 22 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1113
Entity Detected:Fkbp7, FK506 binding protein 7 ( MGI:1336879)
Sequence:sense strand is shown

>T1113
CCCAATTCAGTCTGATCAGCCTGCTGACACTCTGTGGGGCTTACACTGGGCCTGGGAGTGCTGCTTTGGG
AAACATGAATCTCCTATTCAGACTAGCAGTTTTCCTTAGCCTGTGGTGTTGTTCCGATGCTCAGGGACAA
ACAAAAGAAGAAAGCACTGAGGAAGTGAAAATAGAAGTTTTGCACCGTCCAGAAAACTGCTCCAAAACAA
GCAGGAAAGGAGACTTGCTAAATGCCCATTACGATGGCTACTTGGCTAAAGACGGCTCCAAATTCTACTG
CAGCCGGACACAAGATGAAGGCCACCCCAAATGGTTTGTTCTTGGTGTCGGACATGTCATAAAGGGGCTG
GACATTGCTATGATGGACATGTGCCCTGGGGAAAAGAGAAAGGTGATTATACCGCCTTCGTTTGCATATG
GAAAAGAAGGCTACGCAGAAGGCAAGATTCCACCCAATGCAACTCTGATGTTTGAGATTGAACTTTATGC
TGTGACCAAAGGACCAAGGAGCATTGAAACATTTAAGCAAATAGACACGGATAATGACCG
Notes:The probe template was PCR amplified from IMAGE:2135337 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2135337 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002949 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS