Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31082

Sema6a ( MGI:1203727)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31082 EMAGE:31082 EMAGE:31082 EMAGE:31082 EMAGE:31082
euxassay_011666_01 euxassay_011666_02 euxassay_011666_03 euxassay_011666_04 euxassay_011666_05
EMAGE:31082 EMAGE:31082 EMAGE:31082 EMAGE:31082 EMAGE:31082
euxassay_011666_06 euxassay_011666_07 euxassay_011666_08 euxassay_011666_09 euxassay_011666_10
EMAGE:31082 EMAGE:31082 EMAGE:31082 EMAGE:31082 EMAGE:31082
euxassay_011666_11 euxassay_011666_12 euxassay_011666_13 euxassay_011666_14 euxassay_011666_15
EMAGE:31082 EMAGE:31082 EMAGE:31082 EMAGE:31082 EMAGE:31082
euxassay_011666_16 euxassay_011666_17 euxassay_011666_18 euxassay_011666_19 euxassay_011666_20
EMAGE:31082 EMAGE:31082 EMAGE:31082
euxassay_011666_21 euxassay_011666_22 euxassay_011666_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 07 23
midbrain meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
metanephros
moderate moderate
regionalmoderate expression: see section 09 10 11 18 20 21 22 weak expression: see section 12 19
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 23
clavicle
moderate moderate
regionalmoderate expression: see section 11 17
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 16 17
telencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 08 09 10 11 12 13 14 15 16 17 18 20 21
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 weak expression: see section 08 09 10 11 12 13 14 15 16 17 18 20 21 22
cochlea
moderate moderate
regionalmoderate expression: see section 05 06 07 09 weak expression: see section 08 17 18 20 21
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 23
vibrissa
weak weak
regionalweak expression: see section 03 04 05 06 19 20 21
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 20 21 22 23 weak expression: see section 04 05 06 07 18 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 15 16
cranial muscle
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 22 23
neural retina
weak weak
regionalweak expression: see section 01 02 22 23
mandible
moderate moderate
regionalmoderate expression: see section 02 05 06 07 08 09 10 11 12 15 16 17 18 22 weak expression: see section 04 19 20 21
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 14 15 16 weak expression: see section 12
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 06 23
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
palatal shelf
weak weak
regionalweak expression: see section 10 11 12 14 16
thyroid cartilage
weak weak
regionalweak expression: see section 13 14 15
diencephalon meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
pons ventricular layer
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 06 07 09 10 11 12 16 weak expression: see section 08 17 18
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 06 23
tongue muscle
weak weak
regionalweak expression: see section 11 12 13 14 15
hindbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 weak expression: see section 19
hand mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 14 15 17
maxilla
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 16 17 18 weak expression: see section 19 20
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15 16
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31976
Entity Detected:Sema6a, ( MGI:1203727)
Sequence:sense strand is shown

>T31976
CTGAACTGCTCGGTGCCTGGAGACTCTCATTTTTATTTCAATATACTCCAGGCAGTTACAGATGTGATTC
GCATTAATGGCCGTGATGTTGTCTTGGCAACCTTTTCCACACCTTATAACAGCATCCCAGGTTCTGCAGT
CTGTGCCTATGACATGCTTGACATTGCTAATGTTTTCACTGGGAGGTTCAAGGAACAGAAATCACCTGAC
TCTACCTGGACACCCGTTCCAGACGAACGAGTCCCTAAGCCCAGGCCAGGCTGTTGTGCTGGATCATCCT
CTTTAGAAAAATATGCAACCTCCAATGAGTTTCCCGATGATACCCTGAACTTCATTAAGACGCATCCACT
CATGGACGAGGCAGTGCCTTCCATCATCAACAGACCTTGGTTCCTGAGAACAATGGTCAGATACCGCCTG
ACCAAAATTGCAGTAGACAACGCTGCCGGGCCATATCAGAATCACACTGTGGTTTTCCTGGGATCAGAAA
AGGGAATCATCCTGAAGTTCTTGGCCAGGATAGGAAGCAGTGGTTTCCTAAATGGCAGCCTTTTCCTGGA
GGAGATGAATGTTTACAACCCAGAAAAGTGCAGCTATGATGGTGTAGAAGACAAAAGGATCATGGGCATG
CAGCTCGACAGAGCGAGTGGCTCACTCTATGTTGCATTCTCTACTTGTGTGATCAAGGTGCCTCTTGGCC
GCTGTGAGCGACATGGGAAGTGTAAAAAAACCTGCATCGCCTCCAGAGACCCGTATTGTGGGTGGGTAAG
GGAAAGTGGTTCCTGTGCCCATCTGTCACCCCTTAGCAGACTGACATTTGAGCAGGACATTGAGCGTGGC
AATACGGACGGCCTAGGAGACTGTCACAATTCCTTCGTGGCACTGAATGGGCACGCCAGTTCCCTCTATC
CCAGCACCACTACGTCAGATTCGGCATCCCGAGACGGGTATGAGTCTAGGGGAGGCATGCTGGACTGGAA
CGACCTGCTC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6417475), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59689. Forward Primer - name:059689_F_IRAV116_a06_Sema6a, sequence:CTGAACTGCTCGGTGCCT; Reverse Primer - name:059689_R_SP6_IRAV116_a06_Sema6a, sequence:CGAGCAGGTCGTTCCAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011666 same experiment
 EMAGE:29391 same embryo
 EMAGE:29335 same embryo
 EMAGE:31078 same embryo
 EMAGE:29389 same embryo
 EMAGE:29338 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS