Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31088

Pdlim1 PDZ and LIM domain 1 (elfin) ( MGI:1860611)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088
euxassay_000772_01 euxassay_000772_02 euxassay_000772_03 euxassay_000772_04 euxassay_000772_05
EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088
euxassay_000772_06 euxassay_000772_07 euxassay_000772_08 euxassay_000772_09 euxassay_000772_10
EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088
euxassay_000772_11 euxassay_000772_12 euxassay_000772_13 euxassay_000772_14 euxassay_000772_15
EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088
euxassay_000772_16 euxassay_000772_17 euxassay_000772_18 euxassay_000772_19 euxassay_000772_20
EMAGE:31088 EMAGE:31088 EMAGE:31088 EMAGE:31088
euxassay_000772_21 euxassay_000772_22 euxassay_000772_23 euxassay_000772_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
esophagus
weak weak
regionalweak expression: see section 12 13
embryo
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05 22 23 24
oral epithelium
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 12 13 14 15 16 17
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 13 14 17 18 19
pharynx epithelium
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
laryngeal cartilage
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14 15
pharynx
weak weak
regionalweak expression: see section 17 not examined expression: see section 07 08 09 10 11 12 13 14 18
urethra of male
weak weak
regionalweak expression: see section 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1027
Entity Detected:Pdlim1, PDZ and LIM domain 1 (elfin) ( MGI:1860611)
Sequence:sense strand is shown

>T1027
TCCTCGAGNCTGTTGGCCTACTGGAGCTGCTCCGGGAGCCCCGCGCGCCGTGCAGTTCTGTGCCTTGCCT
GTCTGTCCCTTCCGATTGTGCCTAGCGATGACCACCCAGCAGATTGTTCTCCAGGGCCCGGGTCCCTGGG
GTTTCCGCCTCGTGGGCGGCAAGGACTTCGAACAACCTCTCGCCATTTCCCGGGTCACTCCCGGAAGCAA
GGCTGCTATAGCGAATTTATGTATTGGAGATTTAATCACAGCCATCGATGGGGAAGATACCAGCAGCATG
ACACACTTGGAAGCTCAGAACAAAATCAAGGGCTGCGCAGACAACATGACGCTCACAGTATCCAGGTCTG
AACAGAAGATTTGGTCTCCTCTAGTGACCGAGGAGGGGAAACGTCATCCCTACAAGATGAATTTAACGTC
GGAACCCCAAGAAGTCCTGCACATAGGAAGTGCCCACAACCGAAGTGCCATGCCATTTACTGCCTCACCT
GCTCCCAGCACCCGGGTCATCACAAACCAGTACAACAGCCCAACTGGCCTCTACTCATCCGAAAACATCT
CTAACTTC
Notes:The probe template was PCR amplified from IMAGE:2076828 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2076828 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000772 same experiment
 EMAGE:31075 same embryo
 EMAGE:29331 same embryo
 EMAGE:29332 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS