Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31091

Papd7 PAP associated domain containing 7 ( MGI:2682295)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31091 EMAGE:31091 EMAGE:31091 EMAGE:31091 EMAGE:31091
euxassay_002954_01 euxassay_002954_02 euxassay_002954_03 euxassay_002954_04 euxassay_002954_05
EMAGE:31091 EMAGE:31091 EMAGE:31091 EMAGE:31091 EMAGE:31091
euxassay_002954_06 euxassay_002954_07 euxassay_002954_08 euxassay_002954_09 euxassay_002954_10
EMAGE:31091 EMAGE:31091 EMAGE:31091 EMAGE:31091 EMAGE:31091
euxassay_002954_11 euxassay_002954_12 euxassay_002954_13 euxassay_002954_14 euxassay_002954_15
EMAGE:31091 EMAGE:31091 EMAGE:31091 EMAGE:31091 EMAGE:31091
euxassay_002954_16 euxassay_002954_17 euxassay_002954_18 euxassay_002954_19 euxassay_002954_20
EMAGE:31091 EMAGE:31091 EMAGE:31091
euxassay_002954_21 euxassay_002954_22 euxassay_002954_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 19 20 21 22
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 18 19
vibrissa
weak weak
regionalweak expression: see section 07 08 09 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T277
Entity Detected:Papd7, PAP associated domain containing 7 ( MGI:2682295)
Sequence:sense strand is shown

>T277
CCAGACCAGGGTTACTATCCCTCCACCAACCCTCGGAGTCGCCCCTGTTCCTTGCAGACAGGCTGGTGTC
GACGGAACCACATCTTTGAAGGCTGTTCACAGTGTAACTTCCCCAGCCATTCCCTCGGCATCCCCCAACC
CACTGTCTAGTCCTCATCTGTATCACAAGCAGCACAATGGCATGAAACTGTCCATGAAAGGCTCCCACAA
CCACACTCAGGGTGGCGGCTACAGCTCTGTGGGCAGTGGAGCTGTGAGGCCTCCTGTAGGCAACCGAGGA
CATCATCAGTACAACCGCACCGGCTGGAGGAGAAAAAAGCACGCACACACAAGGGACAGCCTGCCCGTGA
GTCTCAGCAGATAATGGTCCTGACTGACTGCCCAAAGGCCTCGCTCGGGCACCACAGGGGAGCCGAGACC
AGCATCCAGCACCTCCACCGCTGTCTGCCAAGCGCAGCCCAGCACTGGTCACTCTGCATGTTTGTGTGGT
GGCCGCATCCATCTTACAGAACAGCTC
Notes:The probe template was PCR amplified from IMAGE:2655369 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2655369 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002954 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS