Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31102

Slc2a1 solute carrier family 2 (facilitated glucose transporter), member 1 ( MGI:95755)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31102 EMAGE:31102 EMAGE:31102 EMAGE:31102 EMAGE:31102
euxassay_000500_01 euxassay_000500_02 euxassay_000500_03 euxassay_000500_04 euxassay_000500_05
EMAGE:31102 EMAGE:31102 EMAGE:31102 EMAGE:31102 EMAGE:31102
euxassay_000500_07 euxassay_000500_08 euxassay_000500_09 euxassay_000500_10 euxassay_000500_11
EMAGE:31102 EMAGE:31102 EMAGE:31102 EMAGE:31102 EMAGE:31102
euxassay_000500_12 euxassay_000500_13 euxassay_000500_14 euxassay_000500_17 euxassay_000500_18
EMAGE:31102 EMAGE:31102 EMAGE:31102 EMAGE:31102 EMAGE:31102
euxassay_000500_19 euxassay_000500_20 euxassay_000500_21 euxassay_000500_22 euxassay_000500_23
EMAGE:31102
euxassay_000500_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
inner ear vestibular component
strong strong
regionalstrong expression: see section 02 22 moderate expression: see section 21 24 weak expression: see section 20
stomach
moderate moderate
regionalmoderate expression: see section 08
stomach proventricular region lumen
moderate moderate
regionalmoderate expression: see section 02 06 07 08 09
sublingual gland primordium
strong strong
single cellstrong expression: see section 23 moderate expression: see section 13 weak expression: see section 16
otic capsule
strong strong
regionalstrong expression: see section 02 03 22 moderate expression: see section 11 21 24 weak expression: see section 20
meckel's cartilage
strong strong
spottedstrong expression: see section 14 23 moderate expression: see section 11 12 13 17 18 weak expression: see section 16
submandibular gland primordium
strong strong
spottedstrong expression: see section 14 moderate expression: see section 13 weak expression: see section 16
basisphenoid bone
strong strong
regionalstrong expression: see section 22 moderate expression: see section 21 24 weak expression: see section 03
gut
moderate moderate
regionalmoderate expression: see section 24
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 07 08 09 24 weak expression: see section 18 19 20
labyrinth
strong strong
regionalstrong expression: see section 03
nucleus pulposus
strong strong
homogeneousstrong expression: see section 04 moderate expression: see section 13
lower jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 05 10 11
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3748
Entity Detected:Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1 ( MGI:95755)
Sequence:sense strand is shown

>T3748
TGGCCTCGAGCCAGATTCGGACGAGGGTTTTATAATTTTTTTATTACTGATTTTGTTATTTTTTTTTTTT
TATCAGCCACTCTCCTATCTCCACACTGTAGTCTTCACCTTGATTGGCCCAGTGCCTGAGGGTGGGGACC
ACGCCCTGTCCAGACACTTGCCTTCTTTGCCAAGCTAATCTGTAGGGCTGGACCTATGGCCAAGGACACA
CTAATACCGAACTCTGAGCTAGGAGGCTTTACCGCTGGAGGCGGTAGCTGCCACCCACTTCCGCAGGCCT
GGACCTCGGCACCATAGGGGTCCGGACTCCATTTTAGGATTCGCCCATTCCTGTCTCTTCCTACCCAACC
ACTCAATTAATCTTTCCTTGCCTGAGACCAGTTGGAAGCACTGGAGTGCAGGGAGGAGAGGGAAGGGCCA
GGCTGGGCTGCCAGGTTCTAGTCTCCTGTGCACTGAGGGCCACACAAACACCATGAGAAGGACCTCGGAG
GCTGAGAACTTAACTGCTGAAGACACGGACACTCCTGCCCTGCTGTGTATAGATGGAAGATATTTATATA
Notes:The probe template was PCR amplified from IMAGE:373704 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:373704 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000500 same experiment
 EMAGE:31101 same assay
 EMAGE:31073 same embryo
 EMAGE:31076 same embryo
 EMAGE:31101 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS