Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31103

Hoxa13 homeobox A13 ( MGI:96173)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31103 EMAGE:31103 EMAGE:31103 EMAGE:31103 EMAGE:31103
euxassay_000981_01 euxassay_000981_02 euxassay_000981_03 euxassay_000981_04 euxassay_000981_05
EMAGE:31103 EMAGE:31103 EMAGE:31103 EMAGE:31103 EMAGE:31103
euxassay_000981_06 euxassay_000981_07 euxassay_000981_08 euxassay_000981_09 euxassay_000981_10
EMAGE:31103 EMAGE:31103 EMAGE:31103 EMAGE:31103 EMAGE:31103
euxassay_000981_11 euxassay_000981_12 euxassay_000981_13 euxassay_000981_14 euxassay_000981_15
EMAGE:31103 EMAGE:31103 EMAGE:31103 EMAGE:31103 EMAGE:31103
euxassay_000981_16 euxassay_000981_17 euxassay_000981_18 euxassay_000981_19 euxassay_000981_20
EMAGE:31103 EMAGE:31103 EMAGE:31103
euxassay_000981_21 euxassay_000981_22 euxassay_000981_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
genital tubercle of female
moderate moderate
regionalmoderate expression: see section 12 15
hindlimb digit 5 mesenchyme
strong strong
gradedstrong expression: see section 07 08 09 17 18 20 21 moderate expression: see section 21
forelimb digit 2 phalanx
strong strong
gradedstrong expression: see section 06 07 08 21 22 moderate expression: see section 04
hindlimb digit 1 mesenchyme
strong strong
gradedstrong expression: see section 04 05 06 19 20 07 moderate expression: see section 21
urachus
moderate moderate
homogeneousmoderate expression: see section 13
forelimb digit 3 phalanx
strong strong
gradedstrong expression: see section 06 07 08 09 23 05 moderate expression: see section 04 05
hindlimb digit 4 mesenchyme
strong strong
gradedstrong expression: see section 07 08 09 17 18 19 20 21 moderate expression: see section 21
forelimb digit 5 phalanx
strong strong
gradedstrong expression: see section 04 23
spinal cord
moderate moderate
regionalmoderate expression: see section 14 15
ureter
moderate moderate
gradedmoderate expression: see section 15
urethral fold of male
strong strong
regionalstrong expression: see section 13 14 moderate expression: see section 13 14
hindlimb digit 2 mesenchyme
strong strong
gradedstrong expression: see section 06 07 18 19 20 21 moderate expression: see section 05 21
forelimb digit 1 phalanx
strong strong
gradedstrong expression: see section 06 07 21 22
bladder
moderate moderate
homogeneousmoderate expression: see section 13 15
foot
moderate moderate
regionalmoderate expression: see section 03 04
tail spinal cord
moderate moderate
gradedmoderate expression: see section 14 15
hindlimb digit 3 mesenchyme
strong strong
gradedstrong expression: see section 06 07 08 09 17 18 19 20 21 moderate expression: see section 21
tail mesenchyme
moderate moderate
gradedmoderate expression: see section 14 15
forelimb digit 4 phalanx
strong strong
regionalstrong expression: see section 06 23 05 08 moderate expression: see section 04 05
genital tubercle of male
strong strong
homogeneousstrong expression: see section 13 14 15 moderate expression: see section 12 13 14
hand
moderate moderate
regionalmoderate expression: see section 01 02 03 04
glans of male genital tubercle
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5309
Entity Detected:Hoxa13, homeobox A13 ( MGI:96173)
Sequence:sense strand is shown

>T5309
CCGGCTACCTGGATATGCCAGTAGTTCCGGGGCTCGGGGGTCCTGGCGAGTCGCGCCACGAGCCTCTGGG
GCTTCCCATGGAAAGCTATCAGCCCTGGGCTCTGCCCAACGGCTGGAACGGCCAAATGTACTGCCCCAAA
GAGCAGACGCAGCCTCCCCACCTCTGGAAGTCCACTCTGCCCGACGTCGTCTCCCATCCTTCAGACGCCA
GCTCCTATAGGAGGGGGAGAAAGAAGCGCGTGCCTTACACTAAGGTGCAGTTGAAAGAACTCGAACGGGA
ATACGCTACGAACAAATTCATTACCAAGGACAAACGGAGGAGGATATCAGCCACGACAAACCTCTCTGAG
AGGCAGGTCACAATCTGGTTCCAGAACAGGAGGGTCAAAGAGAAAAAAGTCATCAATAAACTC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers.. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000981 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS