Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31105

Evx1 even skipped homeotic gene 1 homolog ( MGI:95461)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31105 EMAGE:31105 EMAGE:31105 EMAGE:31105 EMAGE:31105
euxassay_002923_01 euxassay_002923_02 euxassay_002923_03 euxassay_002923_04 euxassay_002923_05
EMAGE:31105 EMAGE:31105 EMAGE:31105 EMAGE:31105 EMAGE:31105
euxassay_002923_06 euxassay_002923_07 euxassay_002923_08 euxassay_002923_09 euxassay_002923_10
EMAGE:31105 EMAGE:31105 EMAGE:31105 EMAGE:31105 EMAGE:31105
euxassay_002923_11 euxassay_002923_12 euxassay_002923_13 euxassay_002923_14 euxassay_002923_15
EMAGE:31105 EMAGE:31105 EMAGE:31105 EMAGE:31105 EMAGE:31105
euxassay_002923_16 euxassay_002923_17 euxassay_002923_18 euxassay_002923_19 euxassay_002923_20
EMAGE:31105 EMAGE:31105
euxassay_002923_21 euxassay_002923_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 moderate expression: see section 16 17 18
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 moderate expression: see section 17 18 not examined expression: see section 19
ventral grey horn
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17
urethra of male
moderate moderate
regionalmoderate expression: see section 14 15 16
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 moderate expression: see section 16 17 18
pons mantle layer
strong strong
regionalstrong expression: see section 06 07 09 10 11 14 15 19 20 moderate expression: see section 12 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5305
Entity Detected:Evx1, even skipped homeotic gene 1 homolog ( MGI:95461)
Sequence:sense strand is shown

>T5305
CAGCTCCAGCCTTCTCCCTTCCGGTTTGACATTGGCAGGGAAGGGGCAGGGGCTCCAGGGTCCCTAGGCA
GCTTCTGTGGGGCGAACCTCTTCTCCCTTAACCCAGCACACAGCCTGATTAGCAAGTGATGGGTGAGGAG
GGGTTTTTGAATGTTGAATGTATGTATAATAATGATCACCACTCTGCTGGGCCACCAAGCCCGGAGCTGC
TGAGCCGGTCTAACAAGGCGCCCTGGGAAGAGCTTAGGGAACGGAGACTTCTTACATTCTTCTCTCATTG
TCTCCCCAAATTGCCACAGGGCCTTGGCTTTCAGCTGCCAGTACAAACCTTCAGCGCCTCTGGAGGACCC
TGTCTCTCCCCTTCACTGGGGTTTATT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers.. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002923 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS