Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31111

Mgst1 microsomal glutathione S-transferase 1 ( MGI:1913850)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111
euxassay_002928_01 euxassay_002928_02 euxassay_002928_03 euxassay_002928_04 euxassay_002928_05
EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111
euxassay_002928_06 euxassay_002928_07 euxassay_002928_08 euxassay_002928_09 euxassay_002928_10
EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111
euxassay_002928_11 euxassay_002928_12 euxassay_002928_13 euxassay_002928_14 euxassay_002928_15
EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111
euxassay_002928_16 euxassay_002928_17 euxassay_002928_18 euxassay_002928_19 euxassay_002928_20
EMAGE:31111 EMAGE:31111 EMAGE:31111 EMAGE:31111
euxassay_002928_21 euxassay_002928_22 euxassay_002928_23 euxassay_002928_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
pituitary gland
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
rectum
strong strong
regionalstrong expression: see section 16
male reproductive system
strong strong
regionalstrong expression: see section 15
axial musculature
strong strong
regionalstrong expression: see section 04 05 06 07 08 20 21 22 23 24
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22 23
bladder
strong strong
regionalstrong expression: see section 15 16 moderate expression: see section 17
esophagus
moderate moderate
regionalmoderate expression: see section 13 14
pancreas
strong strong
regionalstrong expression: see section 10 11 12 13 17 18 19 20
trachea
strong strong
regionalstrong expression: see section 13 14 15
vibrissa
strong strong
regionalstrong expression: see section 08 09 22 23 moderate expression: see section 06 07 24
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 16 17 18 19 20 21
hindgut
strong strong
regionalstrong expression: see section 15 16 17 moderate expression: see section 18
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
naris
strong strong
regionalstrong expression: see section 14 15 17 18
head mesenchyme
moderate moderate
regionalmoderate expression: see section 04 05 06 07 23 24
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12
kidney calyx
moderate moderate
regionalmoderate expression: see section 09 10 11 12 19 20 21 22 23
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
urethra of male
strong strong
regionalstrong expression: see section 15 16 17
midgut
strong strong
regionalstrong expression: see section 13 14 15 16 17 moderate expression: see section 08 09 10 11 12 18 19 20 21
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 11 18 19 20 21
adrenal gland
strong strong
homogeneousstrong expression: see section 09 10 11 19 20 21
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 14 15 16
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15 16 17
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1086
Entity Detected:Mgst1, microsomal glutathione S-transferase 1 ( MGI:1913850)
Sequence:sense strand is shown

>T1086
NAGNCTGTTGGCCTACTGGAGGACAACTTGCAGCCCTTCTCCCTGGATTCAGTCATTTGAAGACTGAGAC
CAAGATTGGAAGCATGGCCGACCTCAGGCAGCTCATGGACAATGAGGTGTTGATGGCCTTTACCTCCTAT
GCAACGATCATTCTTACCAAGATGATGTTCATGAGCTCTGCGACCGCATTCCAGAGGATAACCAACAAGG
TTTTTGCCAACCCAGAAGACTGCGCTGGCTTTGGCAAGGGAGAGAATGCCAAGAAGTTTGTTCGCACTGA
CGAGAAGGTGGAACGCGTGCGCAGAGCCCACCTGAATGATCTTGAAAACATCGTTCCCTTTCTCGGCATC
GGCCTCCTGTACTCCCTGAGTGGACCAGATCTCTCTACAGCCCTCATGCACTTCAGAATCTTTGTAGGTG
CTCGGATCTACCACACCATTGCTTACTTGACTCCCCTTCCTCAGCCAAACAGGGGCTTGGCATTTTTTGT
TGGCTATGGAGTTACTTTGTCAATGGCTTACAGGCTGCTAAGGAGCAGACTGTACTTGTAAAGA
Notes:The probe template was PCR amplified from IMAGE:2123093 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2123093 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002928 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS