Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31125

Gpr56 G protein-coupled receptor 56 ( MGI:1340051)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125
euxassay_000980_01 euxassay_000980_02 euxassay_000980_03 euxassay_000980_04 euxassay_000980_05
EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125
euxassay_000980_06 euxassay_000980_07 euxassay_000980_08 euxassay_000980_09 euxassay_000980_10
EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125
euxassay_000980_11 euxassay_000980_12 euxassay_000980_13 euxassay_000980_14 euxassay_000980_15
EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125
euxassay_000980_16 euxassay_000980_17 euxassay_000980_18 euxassay_000980_19 euxassay_000980_20
EMAGE:31125 EMAGE:31125 EMAGE:31125 EMAGE:31125
euxassay_000980_21 euxassay_000980_22 euxassay_000980_23 euxassay_000980_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
oral epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
foregut-midgut junction
moderate moderate
regionalmoderate expression: see section 13 15 16 17 18
vestibulocochlear viii ganglion vestibular component
strong strong
homogeneousstrong expression: see section 08 09 20 moderate expression: see section 19 21
superior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 08 09 20
inferior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 08 09 moderate expression: see section 21
testis
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 14 15
esophagus
moderate moderate
regionalmoderate expression: see section 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 12 13 14 17 18 19
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 10 11 19 20
thymus primordium
strong strong
homogeneousstrong expression: see section 13 14 15 16 17
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 10 19 20 21 22 23 24
kidney pelvis
moderate moderate
homogeneousmoderate expression: see section 10
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 22 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 16 17 18 19
hindgut
moderate moderate
regionalmoderate expression: see section 13 15
laryngeal cartilage
moderate moderate
regionalmoderate expression: see section 15 16 17
stomach
moderate moderate
regionalmoderate expression: see section 02 04 05 06 07 08 09 10 11 12
kidney calyx
moderate moderate
homogeneousmoderate expression: see section 08 09 11 12 18 19 21 22
trachea cartilaginous ring
weak weak
regionalweak expression: see section 16
retina
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 24
midgut
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 15 16 17 18
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 16 17 18 19 20
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 18 19 20 21 22
liver lobe
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 14 17 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1060
Entity Detected:Gpr56, G protein-coupled receptor 56 ( MGI:1340051)
Sequence:sense strand is shown

>T1060
GTTGGCCTACTGGTCCGAGCTTCATCTTCTCCTTCCACAATGCCCCACACAAGGTCTCCCACAATGCATC
TGTGGACATGTGTGATCTCAAGAAGGAATTGCAGCAGCTTAGCAGGTACCTGCAGCACCCTCAAAAGGCT
GCCAAGCGGCCCACCGCAGCGTTCATCAGCCAGCAGTTACAGAGCCTGGAGTCAAAGCTGACCTCTGTGA
GCTTCCTGGGAGACACATTATCCTTTGAGGAGGACCGGGTCAATGCTACAGTGTGGAAGCTGCCACCCAC
AGCCGGTCTAGAGGATCTGCATATCCACTCCCAGAAGGAGGAGGAGCAGAGTGAGGTCCAGGCATACTCG
CTGTTGCTTCCCCGGGCCGTATTCCAGCAGACCAGAGGCCGTCGCCGGGATGACGCCAAGAGGCTCCTGG
TAGTAGACTTCAGCAGCCAAGCTTTGTTCCAGGACAAGAATTCTAGCCAAGTCCTGGGTGAGAAGGTCTT
GGGTATTGTCGTGCAGAACACCAAAGTCACCAACCTCTCAGATCCGGTGGTACTCACCTTCCAGCACC
Notes:The probe template was PCR amplified from IMAGE:2099401 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2099401 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000980 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS