Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31128

Ywhab tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide ( MGI:1891917)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31128 EMAGE:31128 EMAGE:31128 EMAGE:31128 EMAGE:31128
euxassay_000510_01 euxassay_000510_02 euxassay_000510_03 euxassay_000510_04 euxassay_000510_05
EMAGE:31128 EMAGE:31128 EMAGE:31128 EMAGE:31128 EMAGE:31128
euxassay_000510_06 euxassay_000510_07 euxassay_000510_08 euxassay_000510_09 euxassay_000510_10
EMAGE:31128 EMAGE:31128 EMAGE:31128 EMAGE:31128 EMAGE:31128
euxassay_000510_11 euxassay_000510_12 euxassay_000510_13 euxassay_000510_14 euxassay_000510_15
EMAGE:31128 EMAGE:31128 EMAGE:31128 EMAGE:31128 EMAGE:31128
euxassay_000510_16 euxassay_000510_17 euxassay_000510_18 euxassay_000510_19 euxassay_000510_20
EMAGE:31128
euxassay_000510_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 07
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 09 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 10 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 17 18 19 20 21
tail dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 17 18 weak expression: see section 07
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 18
medulla oblongata alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 16 17
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 11 12 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
pons mantle layer
weak weak
regionalweak expression: see section 07 08 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2106
Entity Detected:Ywhab, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide ( MGI:1891917)
Sequence:sense strand is shown

>T2106
GCCTTGCAAGATGGTCCCTGGGATGAACAGCTGGTATTTGTATCTAAAGCTCAGACTGGTCCCTTAATAC
CATGGTATTGTGAAGTCTTGATTTTGATCAACATTGACAAGGATTACTGTGTGTTTAATTTTTACAAACT
GAACACTGTGATCATGGGGTTTTATAACTTAGCAGAACTCTTTCTGGTAGGAAAAATAGACCTGAATTAT
GTGTAACTTCTTGGAAAGTTTAATCTGATATCAAAATGGTCACTGAAATACAATTCTGTTGTAAAGCTGT
ACAGAAAGTTCTAGAGATTCTGTGGTGATGCTGGGACTTGGTGAGATGCTGACCACCGGCATCCTGAGTT
TGGTAACTCACAGTAATTCTGCCTGTGGTTGAGGGCTTACCAACCCTTGATCATTCAGGGCTGTTGCCAC
TCAAAAGTTCATGACCACAAATATCTGCAGTGTCTTCTGAGGAAACTCAAAACCTGAAAGTGAACTTCTT
TGGCCGATAATTGGGCTGTGTCACCACAATAAAAAAAGGTCCCGT
Notes:The probe template was PCR amplified from IMAGE:850865 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:850865 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000510 same experiment
 EMAGE:31127 same assay
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS