Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31135

Tesc tescalcin ( MGI:1930803)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31135 EMAGE:31135 EMAGE:31135 EMAGE:31135 EMAGE:31135
euxassay_002934_01 euxassay_002934_02 euxassay_002934_03 euxassay_002934_04 euxassay_002934_05
EMAGE:31135 EMAGE:31135 EMAGE:31135 EMAGE:31135 EMAGE:31135
euxassay_002934_06 euxassay_002934_07 euxassay_002934_08 euxassay_002934_09 euxassay_002934_10
EMAGE:31135 EMAGE:31135 EMAGE:31135 EMAGE:31135 EMAGE:31135
euxassay_002934_11 euxassay_002934_12 euxassay_002934_13 euxassay_002934_14 euxassay_002934_15
EMAGE:31135 EMAGE:31135 EMAGE:31135 EMAGE:31135 EMAGE:31135
euxassay_002934_16 euxassay_002934_17 euxassay_002934_18 euxassay_002934_19 euxassay_002934_20
EMAGE:31135
euxassay_002934_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
epithalamus marginal layer
strong strong
regionalstrong expression: see section 14
adrenal gland
moderate moderate
regionalmoderate expression: see section 08 09 10 11 18 19
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 14 15 16 17 18 19
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 14 15 16 17 18 19
epithalamus mantle layer
strong strong
regionalstrong expression: see section 11 13
testis
strong strong
regionalstrong expression: see section 05 06 07 08 20 21
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T340
Entity Detected:Tesc, tescalcin ( MGI:1930803)
Sequence:sense strand is shown

>T340
CGCGTCCCCACCCGGCTCCAGCGCAGCGCAGCCCAGGCAGTCCCCGGCCTGCGTGGGGCGCCCGGGGCCC
CGCGGCGCACCATGGGCGCTGCCCACTCGGCGTCCGAGGAGGTGCGGGAGCTCGAGGGCAAGACCGGCTT
CTCCTCGGACCAGATAGAGCAGCTGCATCGGAGGTTCAAGCAGCTAAGCGGGGACCAGCCCACCATTCGC
AAGGAGAACTTCAACAATGTCCCTGACCTGGAGCTCAACCCGATCCGATCCAAAATCGTCCGTGCCTTCT
TTGACAACAGGAACCTGCGAAAGGGATCCAGCGGTCTGGCCGATGAGATCAACTTTGAGGACTTCCTGAC
TATCATGTCCTACTTCCGGCCCATCGACACCACCCTGGGCGAGGAACAGGTGGAGCTGTCACGAAAGGAG
AAGCTGAAATTTCTGTTTCATATGTATGATTCGGACAGTGACGGCCGCATCACCCTGGAAGAGTATAGAA
AT
Notes:The probe template was PCR amplified from IMAGE:3154680 using vector specific primers. Forward Primer - name:RZ. T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3154680 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002934 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS