Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31145

Hpgd ( MGI:108085)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31145 EMAGE:31145 EMAGE:31145 EMAGE:31145 EMAGE:31145
euxassay_013813_01 euxassay_013813_02 euxassay_013813_03 euxassay_013813_04 euxassay_013813_05
EMAGE:31145 EMAGE:31145 EMAGE:31145 EMAGE:31145 EMAGE:31145
euxassay_013813_06 euxassay_013813_07 euxassay_013813_08 euxassay_013813_09 euxassay_013813_10
EMAGE:31145 EMAGE:31145 EMAGE:31145 EMAGE:31145 EMAGE:31145
euxassay_013813_11 euxassay_013813_12 euxassay_013813_13 euxassay_013813_14 euxassay_013813_15
EMAGE:31145 EMAGE:31145 EMAGE:31145 EMAGE:31145 EMAGE:31145
euxassay_013813_16 euxassay_013813_17 euxassay_013813_18 euxassay_013813_19 euxassay_013813_20
EMAGE:31145 EMAGE:31145
euxassay_013813_21 euxassay_013813_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 weak expression: see section 02 03 04 16 17 18 19
thymus primordium
moderate moderate
regionalmoderate expression: see section 08 09 10 11
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 15 16 weak expression: see section 14
upper lip
moderate moderate
regionalmoderate expression: see section 07 08 16 weak expression: see section 09 14 15 17
lower lip
moderate moderate
regionalmoderate expression: see section 08 weak expression: see section 09 12 13 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38296
Entity Detected:Hpgd, ( MGI:108085)
Sequence:sense strand is shown

>T38296
AGCAGTTCGAACCTCAGAAGACACTGTTCGTCCAGTGTGATGTGGCTGACCAGAAACAACTGAGAGATAC
TTTTAGAAAAGTTGTAGACCATTTCGGAAGATTGGATATTTTGGTCAACAATGCAGGCGTGAACAATGAG
AAAAACTGGGAACAGACTCTACAAATTAATTTGGTTTCTGTTATCGGTGGGACCTATCTTGGTTTGGATT
ACATGAGTAAGCAAAACGGAGGTGAAGGCGGCATCATCATCAATATGTCTTCATTAGCAGGGCTCATGCC
TGTTGCGCAGCAACCTGTTTATTGTTCTTCGAAGCACGGCATCATCGGATTCACACGCTCAGCAGCGATG
GCTGCTAACCTCATGAAAAGCGGTGTAAGACTGAATGTCATTTGCCCAGGCTTTGTGGACACACCCATCC
TTGAATCCATTGAAAAAGAAGAAAATATGGGCCAATATATAGGATATAAGGACCAGATCAAGGCTATGAT
GAAATTCTATGGGGTTTTACACCCGTCAGCCATTGCCAATGGATTAATAGATCTCATTGAAGATGATGCT
CTCAATGGTCCCATTATGAAGATCTCGGCATCGGAAGGAATTCATTTTCAAGATTATGACATCTCTCCAT
TACTCGTAAAAGCTCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 143790. Forward Primer - name:143790_F_cDNA_Hpgd, sequence:AGCAGTTCGAACCTCAGAAGAC; Reverse Primer - name:143790_N_SP6_cDNA_Hpgd, sequence:TGGAGCTTTTACGAGTAATGGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_013813 same experiment
 EMAGE:30814 same embryo
 EMAGE:31814 same embryo
 EMAGE:30135 same embryo
 EMAGE:30166 same embryo
 EMAGE:30132 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS