Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31151

Rbbp7 retinoblastoma binding protein 7 ( MGI:1194910)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31151 EMAGE:31151 EMAGE:31151 EMAGE:31151 EMAGE:31151
euxassay_000288_01 euxassay_000288_02 euxassay_000288_03 euxassay_000288_04 euxassay_000288_05
EMAGE:31151 EMAGE:31151 EMAGE:31151 EMAGE:31151 EMAGE:31151
euxassay_000288_06 euxassay_000288_07 euxassay_000288_08 euxassay_000288_09 euxassay_000288_10
EMAGE:31151 EMAGE:31151 EMAGE:31151 EMAGE:31151 EMAGE:31151
euxassay_000288_11 euxassay_000288_12 euxassay_000288_13 euxassay_000288_14 euxassay_000288_15
EMAGE:31151 EMAGE:31151 EMAGE:31151 EMAGE:31151 EMAGE:31151
euxassay_000288_16 euxassay_000288_17 euxassay_000288_18 euxassay_000288_19 euxassay_000288_20
EMAGE:31151 EMAGE:31151
euxassay_000288_21 euxassay_000288_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 moderate expression: see section 06 07 08
metencephalon rest of alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 14 15 16 17 18 19
cranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3585
Entity Detected:Rbbp7, retinoblastoma binding protein 7 ( MGI:1194910)
Sequence:sense strand is shown

>T3585
GAAATTGTGGATGCTAAAGCAATCTTTACTGGCCACTCAGCTGTTGTAGAGGATGTGGCCTGGCATCTGC
TGCATGAGTCCTTGTTTGGATCTGTTGCTGATGATCAGAAACTTATGATATGGGACACCAGATCCAATAC
CACTTCTAAGCCGAGCCATTTGGTGGATGCACACACCGCTGAGGTCAACTGCCTCTCATTCAATCCCTAC
AGCGAGTTCATTCTGGCAACTGGCTCTGCAGATAAGACTGTAGCTTTATGGGACCTGCGTAATCTGAAAC
TAAAACTCCACACCTTTGAATCGCATAAGGATGAAATTTTCCAGGTCCACTGGTCTCCACATAATGAAAC
TATTCTGGCCTCAAGTGGTACTGATCGCCGCCTGAATGTGTGGGATTTAAGTAAAATTGGAGAAGAACAA
TCAGCAGAAGATGCAGAAGATGGGCCTCCAGAGCTCCTGTTTATTCATGGAGGGCACACTGCCAAGATTT
CTGACTTCAGCTGGAATCCCAATGAACCTTGGGTCATTTGCTCTGTGTCTGAA
Notes:The probe template was PCR amplified from IMAGE:3167347 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167347 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000288 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS