Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31164

Lancl1 LanC (bacterial lantibiotic synthetase component C)-like 1 ( MGI:1336997)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31164 EMAGE:31164 EMAGE:31164 EMAGE:31164 EMAGE:31164
euxassay_012275_01 euxassay_012275_02 euxassay_012275_03 euxassay_012275_04 euxassay_012275_05
EMAGE:31164 EMAGE:31164 EMAGE:31164 EMAGE:31164 EMAGE:31164
euxassay_012275_06 euxassay_012275_07 euxassay_012275_08 euxassay_012275_09 euxassay_012275_10
EMAGE:31164 EMAGE:31164 EMAGE:31164 EMAGE:31164 EMAGE:31164
euxassay_012275_11 euxassay_012275_12 euxassay_012275_13 euxassay_012275_14 euxassay_012275_15
EMAGE:31164 EMAGE:31164 EMAGE:31164 EMAGE:31164 EMAGE:31164
euxassay_012275_16 euxassay_012275_17 euxassay_012275_18 euxassay_012275_19 euxassay_012275_20
EMAGE:31164 EMAGE:31164
euxassay_012275_21 euxassay_012275_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 13
facial vii ganglion
weak weak
regionalweak expression: see section 02 03 18 19
vagus x ganglion
strong strong
regionalstrong expression: see section 06 15
thymus primordium
weak weak
regionalweak expression: see section 09 10 12
trigeminal v ganglion
weak weak
regionalweak expression: see section 01 02 03 04 05 06 15 16 17 18 19 20
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 12 13 14 moderate expression: see section 08 09 15 weak expression: see section 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 15 16 17 moderate expression: see section 04
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 moderate expression: see section 16 weak expression: see section 04
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30413
Entity Detected:Lancl1, LanC (bacterial lantibiotic synthetase component C)-like 1 ( MGI:1336997)
Sequence:sense strand is shown

>T30413
ACAGTGAGAAGCAGGCCGAGGAGTGCATCACACGGCTCATTCACCTAAATAAGATTGATCCCCACGTACC
AAATGAAATGCTCTATGGCCGCATAGGCTACATCTTTGCTCTGCTTTTTGTCAATAAGAACTTTGGAGAG
GAGAAGATTCCTCAGAGCCATATTCAGCAGATTTGTGAAAACATCTTAACCTCTGGGGAAAACCTATCTA
GAAAGAGAAACTTGGCGGCAAAGTCTCCACTGATGTATGAGTGGTACCAGGAATATTACGTGGGGGCTGC
TCATGGCTTGGCAGGCATTTATTACTACCTGATGCAGCCCAGCCTTCAGGTGAACCAAGGAAAGTTGCAT
AGTTTGGTGAAGCCCAGTGTAGACTTTGTCTGCCGGCTGAAGTTTCCTTCCGGCAATTACCCTCCATGTT
TGGATGATACCAGAGACCTGCTTGTCCATTGGTGCCACGGTGCTCCTGGGGTCATCTATATGCTCATCCA
AGCATACAAGGTGTTCAAAGAAGAGCGTTACCTGTGTGATGCCCAGCAGTGTGCTGACGTGATCTGGCAG
TACGGGCTACTGAAGAAGGGCTACGGGCTGTGCCATGGTGCTGCAGGGAATGCCTACGCTTTCCTGGCAC
TCTACAACCTCACACAGGATCTGAAGTATCTGTACAGGGCCTGCAAGTTTGCTGAGTGGTGCTTAGACTA
CGGGGAGCACGGATGCAGGACAGCGGACACCCCCTTCTCCCTCTTTGAAGGGATGGCTGGAACAATATAT
TTCTTGGCTGACCTGTTAGTCCCCACAAAGGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6315377), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60182. Forward Primer - name:060182_F_IRAV104_a09_Lancl1, sequence:ACAGTGAGAAGCAGGCCG; Reverse Primer - name:060182_R_SP6_IRAV104_a09_Lancl1, sequence:TGGCCTTTGTGGGGACT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012275 same experiment
 EMAGE:29836 same embryo
 EMAGE:29837 same embryo
 EMAGE:30152 same embryo
 EMAGE:31471 same embryo
 EMAGE:31470 same embryo
 EMAGE:29833 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS