Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31180

S100a10 S100 calcium binding protein A10 (calpactin) ( MGI:1339468)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180
euxassay_000290_01 euxassay_000290_02 euxassay_000290_03 euxassay_000290_04 euxassay_000290_05
EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180
euxassay_000290_06 euxassay_000290_07 euxassay_000290_08 euxassay_000290_09 euxassay_000290_10
EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180
euxassay_000290_11 euxassay_000290_12 euxassay_000290_13 euxassay_000290_14 euxassay_000290_15
EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180
euxassay_000290_16 euxassay_000290_17 euxassay_000290_18 euxassay_000290_19 euxassay_000290_20
EMAGE:31180 EMAGE:31180 EMAGE:31180 EMAGE:31180
euxassay_000290_21 euxassay_000290_22 euxassay_000290_23 euxassay_000290_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 16 17 18
ventral grey horn
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
pectoral girdle and thoracic body wall skeleton
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
cranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
rib
moderate moderate
regionalmoderate expression: see section 05 06 07 08 20 21 22 23
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 14
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 16 17 18
midbrain roof plate
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 10
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22 23
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 09 20 21 22 23
epidermis
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3573
Entity Detected:S100a10, S100 calcium binding protein A10 (calpactin) ( MGI:1339468)
Sequence:sense strand is shown

>T3573
TCNAGCCANNATTCGGCAAGAGGCGGAACGAGGCGCTTCGGGGCCCAGGTTTCGACAGACTCTTCAAAAT
GCCATCCCAAATGGAGCACGCCATGGAAACCATGATGCTTACGTTTCACAGGTTTGCAGGCGACAAAGAC
CACTTGACAAAGGAGGACCTGAGAGTGCTCATGGAACGGGAGTTCCCTGGGTTTTTGGAAAATCAAAAGG
ACCCTCTGGCTGTGGACAAAATAATGAAGGACCTGGACCAGTGCCGAGATGGCAAAGTGGGCTTCCAGAG
CTTTCTATCACTAGTGGCAGGGCTCACCATTGCATGCAATGACTATTTTGTAGTAAACATGAAGCAGAAG
GGGAAGAAGTAGGCCAACTGGAGCACTGGTACCCCCACCCTGGTGCGTGTTCACCCACGGGGTCACTTGA
GGAATCTGCCCCACTGCTTCTTGTGAGCAGATCAGGACCCTTAGGAAATGTGCAAATGAGATCCAACTCC
AATTCAACAATCTGAGAGAGAAAACTTAATCCAATGGCAG
Notes:The probe template was PCR amplified from IMAGE:3167197 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167197 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000290 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS