Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31202

Lrrn1 leucine rich repeat protein 1, neuronal ( MGI:106038)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202
euxassay_000278_01 euxassay_000278_02 euxassay_000278_03 euxassay_000278_04 euxassay_000278_05
EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202
euxassay_000278_06 euxassay_000278_07 euxassay_000278_08 euxassay_000278_09 euxassay_000278_10
EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202
euxassay_000278_11 euxassay_000278_12 euxassay_000278_13 euxassay_000278_14 euxassay_000278_15
EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202
euxassay_000278_16 euxassay_000278_17 euxassay_000278_18 euxassay_000278_19 euxassay_000278_20
EMAGE:31202 EMAGE:31202 EMAGE:31202 EMAGE:31202
euxassay_000278_21 euxassay_000278_22 euxassay_000278_23 euxassay_000278_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 13 14 15 16 17
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
pons marginal layer
moderate moderate
regionalmoderate expression: see section 06 07 16 17
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21
cochlea
strong strong
regionalstrong expression: see section 01 02 21 22
tongue mesenchyme
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 13
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 16 17 18 19 20 21
vibrissa
moderate moderate
regionalmoderate expression: see section 02 03 04 05 18 19
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 06 07 08 09 12 13 14 15
upper lip
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 14 15 16 17 18 19 20
tail
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 11 12
limb
moderate moderate
regionalmoderate expression: see section 01 02 19 20 21 22 23 24
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 13 14 15 16 17
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12
lower lip
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3674
Entity Detected:Lrrn1, leucine rich repeat protein 1, neuronal ( MGI:106038)
Sequence:sense strand is shown

>T3674
TGGCCTCGAGCCAGATTCGGCACGAGGGCTANAAGGTTAAGAGGAAAAATTACCACCATTCGCTGAAAAA
GTATATGCAAAAAACCTCGTCCATCCCACTGAACGAGCTGTACCCCCCACTCATTAACCTCTGGGAAGCT
GACAGTGACAAGGACAAAGATGGCTCGGCAGACACCAAGCCAACCCAGGTTGACACATCCAGAAGCTATT
ACATGTGGTAACTCAGTGGGTGTTTTGCTTCTGGTAGTAAGGAGCACAAAGACATTTTTGCTTTATTCTG
CAAAAGTAACAAGGTGAAGAAGACTTTTGTACTTTTGACTTTGCTAGTTGTGGCAGAGCGGAGAGGATGG
GTGGATATTTCAAAGTTTTTTAGTATAGCGTATCGCAAGGGGGTGGACACAGCTGGTGGTGACTCTCAGC
TTCCAGTTTGTGTTTGGTTTTTATCCTTATCATTATTATGATTATTATTATATTATTATTATCATCATTA
TTTTATTTTAGTTGATTGCTAAACTCAGTAATGCTGTCTTAACTACGATGCTCAATGATTAAT
Notes:The probe template was PCR amplified from IMAGE:351947 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:351947 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000278 same experiment
 EMAGE:29393 same embryo
 EMAGE:29397 same embryo
 EMAGE:30663 same embryo
 EMAGE:30676 same embryo
 EMAGE:30675 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS