Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31230

3110047P20Rik ( MGI:1920464)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31230 EMAGE:31230 EMAGE:31230 EMAGE:31230 EMAGE:31230
euxassay_011144_01 euxassay_011144_02 euxassay_011144_03 euxassay_011144_04 euxassay_011144_05
EMAGE:31230 EMAGE:31230 EMAGE:31230 EMAGE:31230 EMAGE:31230
euxassay_011144_06 euxassay_011144_07 euxassay_011144_08 euxassay_011144_09 euxassay_011144_10
EMAGE:31230 EMAGE:31230 EMAGE:31230 EMAGE:31230 EMAGE:31230
euxassay_011144_11 euxassay_011144_12 euxassay_011144_13 euxassay_011144_14 euxassay_011144_15
EMAGE:31230 EMAGE:31230 EMAGE:31230 EMAGE:31230 EMAGE:31230
euxassay_011144_16 euxassay_011144_17 euxassay_011144_18 euxassay_011144_19 euxassay_011144_20
EMAGE:31230 EMAGE:31230
euxassay_011144_21 euxassay_011144_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 10 11 12 13 14
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 11 12 15 16 17 18
tongue
strong strong
spottedstrong expression: see section 15
epithalamus mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 09 10 15 16 17 weak expression: see section 08 11 14
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 11 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 16 17 weak expression: see section 08 11 18 19
dorsal root ganglion
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 09 10 11 12
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 09 10 15 16 17 weak expression: see section 08 11 14
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 19 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 17 18 19 20 21 22
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 02 03 04 06 07 08 17 18 19 20 21 22
midbrain mantle layer
weak weak
regionalweak expression: see section 08 09 13 16 17 18 19
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 10 11 12 14 15 16 17 18
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37328
Entity Detected:3110047P20Rik, ( MGI:1920464)
Sequence:sense strand is shown

>T37328
ATGTGCTGGATTTACACAGTGGAAAGCTACGGGTGGTTCACGCCTCTGGAGTCATCTGGAGGCAGAGGCT
CTCTCGAGATGGTCGCTACCTGGTGTATATTTGTTTCCGGAATGGGGAGGAGGAGGAGGAAAACGATGCT
ATTTCTAGTTTAATAGTGATGAGACTGGCTGACGGCAAAAACATCGGTGCTTGCTCCCTATACAAAACAC
CAACTTTCCTTGCACTTTCTCAGAGACACCTGAACATCATCGTCGGCTTTGATGATGGGAGTATAGGGAT
ATACACAGTTGTGGATCGTGTAGATGCTGCGTTGAAGATCAAAATTGCCACATCGAATAGCAGACAGATT
TTCAACAATGCAACGCAGACATCCAGGCCAAAGTCAAACAGCTACTCCTTTAAAGTGTCTGTGGATTGCT
TATGGCGAGAGTCCACTGAGGTCTTTGCAAGAGACAGCCCCATCACCGTGAGTGACTCTTCTGAGTCCAA
CGAGGCAACACCCTCCAAGAAACACAATTCTTGTTATGACCGAGTGTGTGCTGCCCTAGAATCCAGGAGC
CACAGCTACACTCCAGATAACTGACACGATGTTTATCCTACTCAACCGAAATACATAATCCATGTATGAC
AGAAGAAAAAAAAAAGCAAAGTGCATCTTCTGGACACAAATGATGAGCTGCTAATTTCTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 87221. Forward Primer - name:087221_F_cDNA_3110047P20Rik, sequence:ATGTGCTGGATTTACACAGTGG; Reverse Primer - name:087221_N_SP6_cDNA_3110047P20Rik, sequence:CCAGAAATTAGCAGCTCATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011144 same experiment
 EMAGE:30219 same embryo
 EMAGE:30218 same embryo
 EMAGE:30244 same embryo
 EMAGE:31025 same embryo
 EMAGE:30242 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS