Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31246

Fdft1 farnesyl diphosphate farnesyl transferase 1 ( MGI:102706)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31246 EMAGE:31246 EMAGE:31246 EMAGE:31246 EMAGE:31246
euxassay_005703_01 euxassay_005703_02 euxassay_005703_03 euxassay_005703_04 euxassay_005703_05
EMAGE:31246 EMAGE:31246 EMAGE:31246 EMAGE:31246 EMAGE:31246
euxassay_005703_06 euxassay_005703_07 euxassay_005703_08 euxassay_005703_09 euxassay_005703_10
EMAGE:31246 EMAGE:31246 EMAGE:31246 EMAGE:31246 EMAGE:31246
euxassay_005703_11 euxassay_005703_12 euxassay_005703_13 euxassay_005703_14 euxassay_005703_15
EMAGE:31246 EMAGE:31246 EMAGE:31246 EMAGE:31246 EMAGE:31246
euxassay_005703_16 euxassay_005703_17 euxassay_005703_18 euxassay_005703_19 euxassay_005703_20
EMAGE:31246 EMAGE:31246 EMAGE:31246
euxassay_005703_21 euxassay_005703_22 euxassay_005703_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
inner ear
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 16 17 18 19 20 21
kidney calyx
strong strong
regionalstrong expression: see section 04 13
tegmentum
strong strong
spottedstrong expression: see section 12 moderate expression: see section 11 13
retina
weak weak
regionalweak expression: see section 01 02 03 04 05 22 23
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 19
lens
strong strong
regionalstrong expression: see section 01 02 03
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 09 weak expression: see section 07 08 22 23
esophagus epithelium
strong strong
regionalstrong expression: see section 09 10
midbrain mantle layer
moderate moderate
spottedmoderate expression: see section 16 17
diencephalon lateral wall mantle layer
strong strong
spottedstrong expression: see section 08 09 moderate expression: see section 10 16
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3857
Entity Detected:Fdft1, farnesyl diphosphate farnesyl transferase 1 ( MGI:102706)
Sequence:sense strand is shown

>T3857
TGGCCTCGAGCCAGATTCGGCACGAGGGTGGGAGCGGGAGATCCCGACAGGTGAGCCCCGCGCCCAGCAG
TCGCAAGGATGGAGTTCGTCAAGTGTCTAGGCCACCCGGAGGAGTTCTATAACCTGCTGCGATTCCGCAT
GGGAGGCCGGCGGAATTTTATACCCAAGATGGACCAGGACTCACTCAGCAGCAGCTTGAAGACCTGCTAC
AAGTATCTCAATCAGACCAGTCGCAGCTTTGCCGCGGTTATCCAGGCGCTGGATGGGGACATACGGCACG
CCATATGTGTGTTCTACCTGGTTCTCCGAGCCCTGGATACAGTGGAGGATGACATGAGCATCAGTGTGGA
GAAGAAGATCCCACTGCTGTGTAACTTCCACACTTTCCTCTATGACCCAGAGTGGCGGTTCACTGAGAGC
AAGGAGAAGGACCGACAAGTGCTGGAGGACTTCCCCACGATCTCCCTGGAGTTTAGAAATTTGGCTGAGA
AATATCAAACAGTGATCGATGACATCTGCCACCGGATGGGGTGTGGGATGGCAGAATTTGTAGACAAG
Notes:The probe template was PCR amplified from IMAGE:424562 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:424562 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_005703 same experiment
 EMAGE:31245 same assay
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS