Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31248

Hsd17b4 ( MGI:105089)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248
euxassay_011373_01 euxassay_011373_02 euxassay_011373_03 euxassay_011373_04 euxassay_011373_05
EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248
euxassay_011373_06 euxassay_011373_07 euxassay_011373_08 euxassay_011373_09 euxassay_011373_10
EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248
euxassay_011373_11 euxassay_011373_12 euxassay_011373_13 euxassay_011373_14 euxassay_011373_15
EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248
euxassay_011373_16 euxassay_011373_17 euxassay_011373_18 euxassay_011373_19 euxassay_011373_20
EMAGE:31248 EMAGE:31248 EMAGE:31248 EMAGE:31248
euxassay_011373_21 euxassay_011373_22 euxassay_011373_23 euxassay_011373_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 23 24
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 24
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 04 06 23 24
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 06 24
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 14 15 16
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 04 06 23 24
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 21 22 23 24
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
upper lip
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 19 20 21 22 23
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
lower lip
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 19 20 21 22
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30098
Entity Detected:Hsd17b4, ( MGI:105089)
Sequence:sense strand is shown

>T30098
TGGATAAAGGCTCTGGCGTAGTGATTGTTATGGACGTCTATTCTTATTCTGGGAAGGAACTTATATGCTA
TAATCAGTTCTCTGTCTTTGTTGTTGGCTCTGGGGGCTTTGGTGGAAAACGGACATCAGAAAAACTCAAA
GCAGCTGTAGCTGTACCAAATCGACCTCCAGATGCTGTACTGAGAGATGCCACCTCACTGAATCAGGCCG
CGCTGTACCGCCTCAGCGGAGACTGGAATCCTCTACACATTGACCCGGACTTTGCGAGCGTTGCCGGTTT
TGAGAAGCCCATATTACATGGACTATGTACCTTTGGATTTTCTGCAAGGCATGTTTTACAGCAGTTTGCA
GATAATGATGTATCAAGATTCAAGGCGATTAAGGTTCGTTTTGCCAAACCAGTGTATCCAGGACAGACTC
TACAAACTGAGATGTGGAAGGAAGGAAACAGAATTCATTTTCAAACCAAGGTCCACGAGACTGGAGATGT
TGTCATTTCAAATGCGTACGTGGATCTCGTGCCTGCATCTGGAGTTTCAACCCAGACACCTTCAGAGGGT
GGAGAGCTCCAGAGTGCTCTTGTGTTTGGGGAGATAGGCCGCCGCCTCAAGAGTGTTGGCCGTGAGGTGG
TAAAGAAAGCGAATGCTGTGTTTGAATGGCATATCACGAAAGGTGGGACTGTTGCAGCCAAGTGGACCAT
TGACCTGAAGAGCGGCTCAGGGGAGGTGTACCAAGGCCCCGCAAAGGGCTCTGCTGATGTGACCATCATC
ATTTCCGATGAGGATTTTATGGAAGTGGTCTTCGGCAAGCTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4209394), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 17235. Forward Primer - name:017235_F_IRAV20-23_N06_Hsd17b4, sequence:TGGATAAAGGCTCTGGCG; Reverse Primer - name:017235_R_SP6_IRAV20-23_N06_Hsd17b4, sequence:TCAAGCTTGCCGAAGAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_011373 same experiment
 EMAGE:31275 same embryo
 EMAGE:29357 same embryo
 EMAGE:31210 same embryo
 EMAGE:31122 same embryo
 EMAGE:29348 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS