Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31257

Elmod1 ( MGI:3583900)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257
euxassay_015979_01 euxassay_015979_02 euxassay_015979_03 euxassay_015979_04 euxassay_015979_05
EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257
euxassay_015979_06 euxassay_015979_07 euxassay_015979_08 euxassay_015979_09 euxassay_015979_10
EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257
euxassay_015979_11 euxassay_015979_12 euxassay_015979_13 euxassay_015979_14 euxassay_015979_15
EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257
euxassay_015979_16 euxassay_015979_17 euxassay_015979_18 euxassay_015979_19 euxassay_015979_20
EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257 EMAGE:31257
euxassay_015979_21 euxassay_015979_22 euxassay_015979_23 euxassay_015979_24 euxassay_015979_25
EMAGE:31257
euxassay_015979_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 11 18
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 05 06 moderate expression: see section 02 03 04 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06 07 19 20 21
telencephalon mantle layer
strong strong
regionalstrong expression: see section 05 06 24 25 26 moderate expression: see section 02 03 04 07 08 19 20 21 22 23
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 10 11 12 15 16 19 20
ventral grey horn
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 weak expression: see section 10 11 12 15 16 19
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 09 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39634
Entity Detected:Elmod1, ( MGI:3583900)
Sequence:sense strand is shown

>T39634
ATGAAGCACTTCCTGAGCTTTCTATCGGAAGGGTGCTGTCTTTTGTTCCCCACAGGATGTTGATCCAGGT
GTGCCTGTATTTTTATTGTAAATTTTTGTGGCGCTGCATGAAGTTTGTGATGCGGAAACTCACCGGAAGG
TGTGAACTGCAAAGGATTTGCTACGGCACCAAACCTGGAGCTTCCAGAACCATGAAAATTGAAACGTCAC
TGAGAGATTCAAAAAGCAAGCTGTTGCAGACATCCGTGAGTGTTCATCCTGATGCTATTGAAAAGACTAT
TGATGACATCATGGAATTGAAAAAATTAACCCTGACATCAATCCACAGTTGGGGATCTCTCTCCAGGCTT
GCCTCCTGCAAATCGTGGGTTACAGAAACCTCATTGCAGATGTGGAAAAACTGCGCAGAGAACCCTATGA
TTCCGACAACCCCCAGCATGAAGAGATGCTTCTGAAGCTATGGGAGCTCCTGAAGCCCAACACTCCACTG
GAGTCTCGGGTTTCGAAGCAGTGGTGTGAGATCGGCTTCCAAGGCGATGATCCGAAAACAGATTTCCGAG
GAATGGGTCTTCTGGGACTTTACAATTTGCAATATTTTGCAGAACGGGATGCCACCGTGGCTCAGCAGGT
CCTCTCCGACTCTGTCCATCCAAAATGCAGCAAATTCAGCAAAATAGAATGGGAAAAGAAAAAGATGGAT
AAAGCCATTGGGTACTCCTTTGCAATTGTGGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 105407. Forward Primer - name:105407_F_cDNA_4831417L10, sequence:ATGAAGCACTTCCTGAGCTTTC; Reverse Primer - name:105407_N_SP6_cDNA_4831417L10, sequence:GCCCACAATTGCAAAGGAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_015979 same experiment
 EMAGE:30043 same embryo
 EMAGE:30041 same embryo
 EMAGE:30937 same embryo
 EMAGE:30936 same embryo
 EMAGE:30046 same embryo
 EMAGE:30931 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS