Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31266

Scoc short coiled-coil protein ( MGI:1927654)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266
euxassay_002885_01 euxassay_002885_02 euxassay_002885_03 euxassay_002885_04 euxassay_002885_05
EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266
euxassay_002885_06 euxassay_002885_07 euxassay_002885_08 euxassay_002885_09 euxassay_002885_10
EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266
euxassay_002885_11 euxassay_002885_12 euxassay_002885_13 euxassay_002885_14 euxassay_002885_15
EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266
euxassay_002885_16 euxassay_002885_17 euxassay_002885_18 euxassay_002885_19 euxassay_002885_20
EMAGE:31266 EMAGE:31266 EMAGE:31266 EMAGE:31266
euxassay_002885_21 euxassay_002885_22 euxassay_002885_23 euxassay_002885_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 13 18 19 20
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23 24
cervical ganglion
moderate moderate
regionalmoderate expression: see section 10 18
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 12 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 19 20
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 14
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1092
Entity Detected:Scoc, short coiled-coil protein ( MGI:1927654)
Sequence:sense strand is shown

>T1092
GTTGGCCTACTGGTTTGCTCATGAGCAAGATGGACGGATTGAGGACAGGGGAGGAGGAAGACAGCACGTT
CACCAGCATTTCTCTTGAAGATGACACAGACCATTCTTTAAAGAGTTGGCGTTCGAGGGCTGAAAGTCTG
CTACCCAAGATGATGAATGCTGACATGGACGCAGTTGATGCTGAAAATCAGGTGGAACTGGAAGAAAAGA
CTCGACTTATTAATCAGGTGTTGGAACTCCAACACACACTTGAAGATCTTTCTGCAAGAGTAGATGCAGT
TAAGGAAGAAAATCTGAAGCTAAAGTCGGAAAATCAAGTTCTCGGACAATATATAGAAAACCTCATGTCT
GCTTCTAGTGTTTTTCAAACAACTGATACAAAAAGCAAAAGGAAGTAAAGGGCTCACCTCCCTCTCTTCT
ATGGATTGCTGCTTTTTTTCTTCCCCCTTAAGGCTTGGATATGATCCAAAAGTTAGAGTATCTTTGTTCT
TCCCTGAGTATTTATAAAGAGAATGTCACATCTAGGTAACACTAATGCTGAACAGGAGCATCTCTGAGTT
AAC
Notes:The probe template was PCR amplified from IMAGE:2123211 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2123211 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_002885 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS