Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31286

E130303B06Rik ( MGI:2142593)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286
euxassay_009274_01 euxassay_009274_02 euxassay_009274_03 euxassay_009274_04 euxassay_009274_05
EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286
euxassay_009274_06 euxassay_009274_07 euxassay_009274_08 euxassay_009274_09 euxassay_009274_10
EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286
euxassay_009274_11 euxassay_009274_12 euxassay_009274_13 euxassay_009274_14 euxassay_009274_15
EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286
euxassay_009274_16 euxassay_009274_17 euxassay_009274_18 euxassay_009274_19 euxassay_009274_20
EMAGE:31286 EMAGE:31286 EMAGE:31286 EMAGE:31286
euxassay_009274_21 euxassay_009274_22 euxassay_009274_23 euxassay_009274_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
not examined not examined
regionalnot examined expression: see section 08
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 14 15 16 17
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 15 16
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2439
Entity Detected:E130303B06Rik, ( MGI:2142593)
Sequence:sense strand is shown

>T2439
TGGCTCGAGCAGATTCGGACGAGGAAANCTGCTCCAGGCTGCGGTAGGATCATGTGCGAGGGCCCGTCCC
GCATCTCTGGACCCATCCCCCCAGACCCCACTCTCTGCCCGGACTACTACCGGCGGCCGGCCTCGGCCCA
AGGACGCCTGGAAGGAAACGCGTTGAAGCTGGACCTGCTGACTTCAGGTCGGGACCTGGACTCCAGTCCT
CCTCGTGGCCCTCGCATCAGGCCTGAAGCCCGAGAGATCCTAGAGCGTGGCCAGCGAGGCGTGGGGGACG
TGCTGCTGCAACTGGGGTGCATCTCCCTCGGTTCGGGGGTCTCTCCTAAGAGGAAGAATCCAAAGGACCA
TGAGAAGGAAAACTTGAGGCGGATCAAAGAGATTCAGAGGCGCTTCCAAGACCAGGAACGCAGCCGGGAA
CAGGGTCAGCCTAAGCCACTGAAGGCACTGTGGCGCTCACCCAAGTATGACAATGTGGAGTCTCGAGTCA
AGGCCAGGATGAAGGAGCTTGGCCCCACCTCTGTGACAGAACCTGCCCACTTTCTGCGGGCACAC
Notes:The probe template was PCR amplified from IMAGE:1245862 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1245862 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_009274 same experiment
 EMAGE:30549 same embryo
 EMAGE:30571 same embryo
 EMAGE:29311 same embryo
 EMAGE:29323 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS