Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31287

Pax2 paired box gene 2 ( MGI:97486)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31287 EMAGE:31287 EMAGE:31287 EMAGE:31287 EMAGE:31287
euxassay_012214_01 euxassay_012214_02 euxassay_012214_03 euxassay_012214_04 euxassay_012214_05
EMAGE:31287 EMAGE:31287 EMAGE:31287 EMAGE:31287 EMAGE:31287
euxassay_012214_06 euxassay_012214_07 euxassay_012214_08 euxassay_012214_09 euxassay_012214_10
EMAGE:31287 EMAGE:31287 EMAGE:31287 EMAGE:31287 EMAGE:31287
euxassay_012214_11 euxassay_012214_12 euxassay_012214_13 euxassay_012214_14 euxassay_012214_15
EMAGE:31287 EMAGE:31287 EMAGE:31287 EMAGE:31287 EMAGE:31287
euxassay_012214_16 euxassay_012214_17 euxassay_012214_18 euxassay_012214_19 euxassay_012214_20
EMAGE:31287 EMAGE:31287 EMAGE:31287
euxassay_012214_21 euxassay_012214_22 euxassay_012214_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
renal cortex
strong strong
regionalstrong expression: see section 05 06 07 08 14 15 16 17
midbrain mantle layer
weak weak
regionalweak expression: see section 07 08 14 15 16
ventral grey horn
strong strong
single cellstrong expression: see section 09 10 11 12 13 14 15
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 14 16 17 18
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 14 15 16 17 18 19 20 moderate expression: see section 11 13 weak expression: see section 09
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 14 15 16 17 18 moderate expression: see section 11 13 weak expression: see section 09 10
dorsal grey horn
strong strong
single cellstrong expression: see section 08 09 10 11 12 13 14 15
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36840
Entity Detected:Pax2, paired box gene 2 ( MGI:97486)
Sequence:sense strand is shown

>T36840
GAGGTATACACTGATCCTGCCCACATTAGAGGAGGTGGAGGTTTACATCTGGTCTGGACTTTAAGAGATG
TGTCTGAGGGCTCTGTCCCTAATGGAGACTCCCAGAGTGGTGTGGACAGTTTGCGGAAGCACCTGCGAGC
CGACACCTTCACCCAGCAGCAGCTGGAAGCTCTGGATCGAGTCTTTGAGCGTCCTTCCTATCCCGATGTC
TTCCAGGCATCAGAGCACATCAAATCAGAACAGGGGAATGAATACTCTCTCCCAGCCCTGACCCCTGGGC
TTGATGAAGTCAAGTCCAGTCTATCTGCATCGGCCAACCCTGAGCTGGGCAGCAATGTGTCAGGCACACA
GACGTACCCCGTTGTGACCGGTCGTGATATGACGAGCACCACTCTACCTGGTTACCCCCCGCATTTGCCC
CCCACTGGCCAGGGAAGCTACCCTACCTCCACCCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96024. Forward Primer - name:096024_F_cDNA_Pax2, sequence:GAGGTATACACTGATCCTGCCC; Reverse Primer - name:096024_N_SP6_cDNA_Pax2, sequence:CAGGGTGGAGGTAGGGTAGCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_012214 same experiment
 EMAGE:30769 same embryo
 EMAGE:30768 same embryo
 EMAGE:32173 same embryo
 EMAGE:31278 same embryo
 EMAGE:32203 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS