Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31296

Fgfr4 fibroblast growth factor receptor 4 ( MGI:95525)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296
euxassay_000477_01 euxassay_000477_02 euxassay_000477_03 euxassay_000477_04 euxassay_000477_05
EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296
euxassay_000477_06 euxassay_000477_07 euxassay_000477_08 euxassay_000477_09 euxassay_000477_10
EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296
euxassay_000477_11 euxassay_000477_12 euxassay_000477_13 euxassay_000477_14 euxassay_000477_15
EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296
euxassay_000477_16 euxassay_000477_17 euxassay_000477_18 euxassay_000477_19 euxassay_000477_20
EMAGE:31296 EMAGE:31296 EMAGE:31296 EMAGE:31296
euxassay_000477_21 euxassay_000477_22 euxassay_000477_23 euxassay_000477_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
single cellweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3820
Entity Detected:Fgfr4, fibroblast growth factor receptor 4 ( MGI:95525)
Sequence:sense strand is shown

>T3820
TGGCCTCGAGNCAGATTCGGACGAGGCGCAGACGACATGAGCCGGGGAGCAGCAATGTTGTATGGGCTAC
GCGGCCCATGGCCGTGGGTCTCCTCGCTGAGCTGCAACCTGATGCATCGACATTTAATGTTGGCAGTGTC
AGGCCTCTGACTTGAGACTACTGCTGTCGCAGATCCTCTCTCTGGCCCTGTTTTGGGGAGGGCCATTCTT
GGTCCTAAGGTTCATAGTTGAGGCCTTCTGTTCCAGCCTTATGCTCCCATCTCAGAGTTCAACTCTCATC
TCAAGATCATGGCCTTGCCCTTGGACTCATCCTCAGAGAAGTTAAGCATTAAGGCCTTGGCACGCAGCCT
CCGTCTCCGGGGCTCTCCGGGACTAGCTGCAAAACTTATGCTCTAAACATTTCTAGTTCCCCCAAACAAC
CTAGAGGCCTTGGGACTTCACATCCCCCAGCACACAAGCCTCACCACCCCCTGCCATCCCCCCTCCATTG
CTTGTTCCAGCATCTTGGTGAAAGGGGCATCAGCTCTGGTGTCCCTGAGAGACGAGA
Notes:The probe template was PCR amplified from IMAGE:406823 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:406823 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_000477 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS