EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31297

Nppb natriuretic peptide type B ( MGI:97368)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


euxassay_002897_01	euxassay_002897_02	euxassay_002897_03	euxassay_002897_04	euxassay_002897_05

euxassay_002897_06	euxassay_002897_07	euxassay_002897_08	euxassay_002897_09	euxassay_002897_10

euxassay_002897_11	euxassay_002897_12	euxassay_002897_13	euxassay_002897_14	euxassay_002897_15

euxassay_002897_16	euxassay_002897_17	euxassay_002897_18	euxassay_002897_19	euxassay_002897_20

euxassay_002897_21	euxassay_002897_22	euxassay_002897_23	euxassay_002897_24

View assay images:
Expression pattern clarity:

Expression Pattern Description

Text Annotation:

Structure

Level

Pattern

Notes

heart ventricle

strong

single cell

strong expression: see section 08 09 10 11 12 13 14 15 16 17 18

Annotation Validation:

text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1653
Entity Detected:	Nppb, natriuretic peptide type B ( MGI:97368)
Sequence:	sense strand is shown >T1653 TGGCCTCGAGCCAGATTCGGACGAGGGAGACAAGGGAGAACACGGCATCATTGCCTGGCCCATCGCTTCT GCGGCATGGATCTCCTGAAGGTGCTGTCCCAGATGATTCTGTTTCTGCTTTTCCTTTATCTGTCACCGCT GGGAGGTCACTCCTATCCTCTGGGAAGTCCTAGCCAGTCTCCAGAGCAATTCAAGATGCAGAAGCTGCTG GAGCTGATAAGAGAAAAGTCGGAGGAAATGGCCCAGAGACAGCTCTTGAAGGACCAAGGCCTCACAAAAG AACACCCAAAAAGAGTCCTTCGGTCTCAAGGCAGCACCCTCCGGGTCCAGCAGAGACCTCAAAATTCCAA GGTGACACATATCTCAAGCTGCTTTGGGCACAAGATAGACCGGATCGGATCCGTCAGTCGTTTGGGCTGT AACGCACTGAAGTTGTTGTAGGAAGACCTCCTGGCTGCAGGAGACTCCAGTTTCTGACTCTGCCTGGGTC TCTTTCCCCAGCTCTGGGACCACCTTTGAAGTGATCCTATTTATTTATTTATTTATATTTATTTTTATTT
Notes:	The probe template was PCR amplified from IMAGE:463618 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:463618 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Organism:	mouse
Age:	14.5 dpc
Theiler Stage:	TS23
Mutations:	none (wild-type)
Preparation:	section

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EurExpress:euxassay_002897 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source