Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31315

Ahsg ( MGI:107189)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31315 EMAGE:31315 EMAGE:31315 EMAGE:31315 EMAGE:31315
euxassay_008849_01 euxassay_008849_02 euxassay_008849_03 euxassay_008849_04 euxassay_008849_05
EMAGE:31315 EMAGE:31315 EMAGE:31315 EMAGE:31315 EMAGE:31315
euxassay_008849_06 euxassay_008849_07 euxassay_008849_08 euxassay_008849_09 euxassay_008849_10
EMAGE:31315 EMAGE:31315 EMAGE:31315 EMAGE:31315 EMAGE:31315
euxassay_008849_11 euxassay_008849_12 euxassay_008849_13 euxassay_008849_14 euxassay_008849_15
EMAGE:31315 EMAGE:31315 EMAGE:31315 EMAGE:31315 EMAGE:31315
euxassay_008849_16 euxassay_008849_17 euxassay_008849_18 euxassay_008849_19 euxassay_008849_20
EMAGE:31315 EMAGE:31315 EMAGE:31315
euxassay_008849_21 euxassay_008849_22 euxassay_008849_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
heart right ventricle
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19 20
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 13 14 15 16 17 18 19
tongue muscle
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02
right atrium
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
foot
strong strong
regionalstrong expression: see section 07 08 09 10 22 23
eye skeletal muscle
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
left atrium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11
heart left ventricle
strong strong
regionalstrong expression: see section 06 07 08 09 10 11
leg muscle
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23
hand
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1263
Entity Detected:Ahsg, ( MGI:107189)
Sequence:sense strand is shown

>T1263
TCCTCGAGACTGTTGGCCTACTGGATTTTCCAGGGCCTCTCTGGAGCAACCATGAAGTCCCTGGTCTTGC
TCCTTTGTTTTGCTCAGCTCTGGGGCTGCCAATCCGCTCCACAAGGTACAGGACTGGGTTTTAGAGAATT
GGCTTGTGATGATCCAGAAGCAGAGCAAGTAGCTTTGTTGGCCGTGGACTACCTCAATAATCATCTTCTT
CAGGGATTCAAACAGGTCTTGAATCAGATCGACAAAGTCAAGGTGTGGTCTCGGCGGCCCTTCGGAGTGG
TGTATGAGATGGAAGTTGACACACTGGAGACCACTTGCCATGCTTTGGACCCCACCCCGCTGGCAAACTG
TTCTGTGAGGCAGCTGACTGAGCACGCGGTGGAGGGAGACTGTGACTTCCACATCCTGAAACAAGACGGC
CAGTTCAGGGTGATGCACACCCAGTGTCATTCCACCCCAGACTCTGCAGAGGACGTTCGTAAGTTGTGCC
CACGGTGCCCACTCCTGACTCCGTTCAACGATACCAACGTGGTCCACACCGTCAACACTGCCCTGGCTGC
CTTC
Notes:The probe template was PCR amplified from IMAGE:2225588 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template usi. T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2225588 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_008849 same experiment
 EMAGE:29441 same embryo
 EMAGE:31233 same embryo
 EMAGE:30368 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS