Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31326

1100001E04Rik ( MGI:1922654)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31326 EMAGE:31326 EMAGE:31326 EMAGE:31326 EMAGE:31326
euxassay_007511_01 euxassay_007511_02 euxassay_007511_03 euxassay_007511_04 euxassay_007511_05
EMAGE:31326 EMAGE:31326 EMAGE:31326 EMAGE:31326 EMAGE:31326
euxassay_007511_06 euxassay_007511_07 euxassay_007511_08 euxassay_007511_09 euxassay_007511_10
EMAGE:31326 EMAGE:31326 EMAGE:31326 EMAGE:31326 EMAGE:31326
euxassay_007511_11 euxassay_007511_12 euxassay_007511_13 euxassay_007511_14 euxassay_007511_15
EMAGE:31326 EMAGE:31326 EMAGE:31326 EMAGE:31326 EMAGE:31326
euxassay_007511_16 euxassay_007511_17 euxassay_007511_18 euxassay_007511_19 euxassay_007511_20
EMAGE:31326 EMAGE:31326 EMAGE:31326
euxassay_007511_21 euxassay_007511_22 euxassay_007511_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 13 17 18 19 20 21 22 moderate expression: see section 12 14
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 10 weak expression: see section 17
eye skeletal muscle
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 21 weak expression: see section 04 22
anterior abdominal wall musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 17 18 19 20 21 22 23 moderate expression: see section 12 13 14 15 16
not examined not examined
regionalnot examined expression: see section 02
nasal cavity olfactory epithelium
strong strong
single cellstrong expression: see section 08 09 10 11 12 15 16 17 18 19
pectoral girdle and thoracic body wall musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 17 18 19 20 21 22 23 moderate expression: see section 12 13 14 15 16
basal columns
strong strong
regionalstrong expression: see section 10 11 12
tongue extrinsic muscle
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
axial musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 17 18 19 20 21 22 23 moderate expression: see section 12 13 14 15 16
pons mantle layer
strong strong
regionalstrong expression: see section 08 10 18 weak expression: see section 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35332
Entity Detected:1100001E04Rik, ( MGI:1922654)
Sequence:sense strand is shown

>T35332
GCATAAAGATGGAAGAGGATGCTTTACTTTCTGATCCAGTGGAAAACTCTGCTGAAGCCCAGGCTGCTAT
CCTTGCTCAGAGCCAGCCCTTTGATGAAGACCCCGAAGGAGCCCCAGATGTGCACGAGGTCTTGAATGAT
AACCTGAACTATGACTTTGAAGACGAATCGGATTTTGAAGACCAGGACCATCTGGATCTTGCAGAGGTTC
CCTATCTTGATGTAATTCCAAACAACGAAGATACCGACTCAGACGCTGATGTAATCCCAGGTCCCTCTGA
GGAGCCTGCTGTGCCTGCCAGCACTGCTGGTTCCCCTGACAAAGAGGAAGGAGCAGCCGGTAACCCCCCC
AACGCAGACCGCCCACTGCCCCGTGTGCCCCAGGGGAAGAAGGGCAAATTTGCCACCCGCTTCTTTCCTT
AGATGTTTTCCCTTCTCTAAGTTGCCAGACAGGGGAAAAGGGTGGGGGTAGACCTGGAATGTCACAGGAA
ACAGTAAAGAGTCTTGAAGATAAAGAACTAAGGATAAGAAGGAGTTCCACCTGATGCTCGGGTCAGGATG
GGAATTCCAAATACACTGCCAGCCCCACTACTGGGGATGCTTGGTATTTTCAGGTGGTAAAAGCAGAGCT
ATTTCTGTGTCATGCCCAGGCGCCTTGGTGCTACCTTGCCTTCTCTTTTACCCCTGATCTAGGCTTTCCT
CTCACTACAGCAGCCCCTTCCTTTAATTGATGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86411. Forward Primer - name:086411_F_cDNA_1100001E04Rik, sequence:GCATAAAGATGGAAGAGGATGC; Reverse Primer - name:086411_N_SP6_cDNA_1100001E04Rik, sequence:ACATCAATTAAAGGAAGGGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_007511 same experiment
 EMAGE:30319 same embryo
 EMAGE:30050 same embryo
 EMAGE:31329 same embryo
 EMAGE:30326 same embryo
 EMAGE:31324 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS