Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31335

Cacna2d1 ( MGI:88295)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31335 EMAGE:31335 EMAGE:31335 EMAGE:31335 EMAGE:31335
euxassay_006438_01 euxassay_006438_02 euxassay_006438_03 euxassay_006438_04 euxassay_006438_05
EMAGE:31335 EMAGE:31335 EMAGE:31335 EMAGE:31335 EMAGE:31335
euxassay_006438_06 euxassay_006438_07 euxassay_006438_08 euxassay_006438_09 euxassay_006438_10
EMAGE:31335 EMAGE:31335 EMAGE:31335 EMAGE:31335 EMAGE:31335
euxassay_006438_11 euxassay_006438_12 euxassay_006438_13 euxassay_006438_14 euxassay_006438_15
EMAGE:31335 EMAGE:31335 EMAGE:31335 EMAGE:31335 EMAGE:31335
euxassay_006438_16 euxassay_006438_17 euxassay_006438_18 euxassay_006438_19 euxassay_006438_20
EMAGE:31335 EMAGE:31335 EMAGE:31335
euxassay_006438_21 euxassay_006438_22 euxassay_006438_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
moderate moderate
single cellmoderate expression: see section 09 11 12
pituitary gland
moderate moderate
regionalmoderate expression: see section 11 12 13 weak expression: see section 10
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 16 17 18 weak expression: see section 12 13
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 06 16 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 17 18
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 08 09 10 11 12 13 14 15 16 17 18
tongue muscle
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
dorsal grey horn
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 moderate expression: see section 08 16 17
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 11 12 13 14 15 not examined expression: see section 10
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 15 16 17 18 19 20 21 weak expression: see section 09 10 11 12 13
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 17 18 19 20 weak expression: see section 01 02 03 04 05 06 07 08 16 21 22 23
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 19 20 weak expression: see section 08 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 moderate expression: see section 10 16 17
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35114
Entity Detected:Cacna2d1, ( MGI:88295)
Sequence:sense strand is shown

>T35114
AGGACAGCTTCTACAAACGGAGCCTAGATAACGATAACTACGTTTTCACTGCGCCCTACTTTAACAAAAG
TGGACCTGGTGCGTATGAATCTGGAATTATGGTAAGCAAAGCAGTAGAACTGTATATCCAAGGAAAACTT
CTTAAGCCCGCAGTTGTGGGAATTAAAATTGATGTAAATTCTTGGATAGAAAATTTTACCAAAACTTCAA
TCAGGGATCCGTGTGCTGGTCCAGTTTGTGACTGCAAAAGAAACAGTGATGTAATGGACTGTGTCATTCT
AGATGATGGTGGATTTCTTTTGATGGCAAATCACGATGATTACACTAATCAGATTGGACGTTTTTTTGGA
GAGATTGACCCAAGCATGATGAGACACCTGGTTAATATATCACTTTATGCATTCAACAAATCATATGACT
ATCAGTCCGTGTGCGATCCAGGGGCAGCACCAAAGCAGGGGGCAGGACATCGCTCAGCATATGTGCCATC
GATTGCAGATATACTGCAGATTGGCTGGTGGGCCACCGCTGCCGCCTGGTCTATTCTCCAGCAGCTGCTC
TTGAGTTTGACATTTCCACGGCTCCTTGAGGCAGTTGAGATGGAGGAAGATGACTTCACAGCCTCCCTGT
CTAAGCAGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74262. Forward Primer - name:074262_F_cDNA_Cacna2d1, sequence:AGGACAGCTTCTACAAACGGAG; Reverse Primer - name:074262_N_SP6_cDNA_Cacna2d1, sequence:GCTCTGCTTAGACAGGGAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006438 same experiment
 EMAGE:30429 same embryo
 EMAGE:29496 same embryo
 EMAGE:29495 same embryo
 EMAGE:31024 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS