Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31340

Cacna2d2 ( MGI:1929813)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31340 EMAGE:31340 EMAGE:31340 EMAGE:31340 EMAGE:31340
euxassay_006439_01 euxassay_006439_02 euxassay_006439_03 euxassay_006439_04 euxassay_006439_05
EMAGE:31340 EMAGE:31340 EMAGE:31340 EMAGE:31340 EMAGE:31340
euxassay_006439_06 euxassay_006439_07 euxassay_006439_08 euxassay_006439_09 euxassay_006439_10
EMAGE:31340 EMAGE:31340 EMAGE:31340 EMAGE:31340 EMAGE:31340
euxassay_006439_11 euxassay_006439_12 euxassay_006439_13 euxassay_006439_14 euxassay_006439_15
EMAGE:31340 EMAGE:31340 EMAGE:31340 EMAGE:31340 EMAGE:31340
euxassay_006439_16 euxassay_006439_17 euxassay_006439_18 euxassay_006439_19 euxassay_006439_20
EMAGE:31340 EMAGE:31340 EMAGE:31340
euxassay_006439_21 euxassay_006439_22 euxassay_006439_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
ventral grey horn
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 12 13 16 17
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19
pons mantle layer
strong strong
regionalstrong expression: see section 08 09 10 12 13 14 15 16 17 18 moderate expression: see section 04 05 06 07
dorsal grey horn
strong strong
regionalstrong expression: see section 09 10
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 04 05 19
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 17 18 19 20 21 weak expression: see section 08
upper lip
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 16 17 18 19 20 21
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 03
midbrain mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 moderate expression: see section 05 06 07
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
lower lip
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 06 07
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35115
Entity Detected:Cacna2d2, ( MGI:1929813)
Sequence:sense strand is shown

>T35115
TCCGCACATCTGTTTTGACTACAATGCGACGGAAGATACCTCAGACTGTGGCCGCGGAGCCTCCTTCCCT
CCGTCGCTGGGCGTCTTGGTTTCCTTGCAGCTTTTGCTCCTCCTGGGCCTGCCACCTCGGCCGCAGCCTC
AAGTCCACTCCTTCGCTGCCTCTCGCCACCTCTGAGCGACCCACACACACACATCATACCCCCGCCTTGG
CCTCCTAGCCTTTCGCTCACCCTCCCATTCCACATTCCCCAATTTAGAGCCTTGGCCACTCTCTCCTGAA
GGACCTGGGTCCCTTCCCCCGGAGCCTGTGCCTTGGGGCAGGGGAACCCCAAAGTAAGGTGCCATGGTGT
TTGGCACTCAAGATTTAGCTCACCCTTGAACTGTCCAAGTGCCCACAGTCCCTAGACTCATCCCTGTGGG
CTAGGACAGGAGGCCACTAGTACTGATGCCAAACCAGGCCTCCACCGACCCACCTGCCTGGAGATTTCCT
CTATGTAGGCAACCCTGCCACTGCTGGGCACCTCTAACTGGCCCTTTGGCCCCACCCAAGCCCAAACTTA
CCTTCTCTGGGGAAAAAAAAAAAGGAAAAATGGTAATATTGAAAAATCCGGGGGGCACCCCCTCCCAAAT
TGGTTCCTGGCCCTTTCAGGTCACAACCCCCCTCCCTTGCAGGTTTCAGAACAGTCTCACAATGACATCA
GTTTAGACACATGCCATATACACTTGGATCTCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90766. Forward Primer - name:090766_F_cDNA_Cacna2d2, sequence:TCCGCACATCTGTTTTGACTAC; Reverse Primer - name:090766_N_SP6_cDNA_Cacna2d2, sequence:CAGAGATCCAAGTGTATATGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_006439 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS