Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:31389

Bnc2 ( MGI:2443805)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:31389 EMAGE:31389 EMAGE:31389 EMAGE:31389 EMAGE:31389
euxassay_016203_01 euxassay_016203_02 euxassay_016203_03 euxassay_016203_04 euxassay_016203_05
EMAGE:31389 EMAGE:31389 EMAGE:31389 EMAGE:31389 EMAGE:31389
euxassay_016203_06 euxassay_016203_07 euxassay_016203_08 euxassay_016203_09 euxassay_016203_10
EMAGE:31389 EMAGE:31389 EMAGE:31389 EMAGE:31389 EMAGE:31389
euxassay_016203_11 euxassay_016203_12 euxassay_016203_13 euxassay_016203_14 euxassay_016203_15
EMAGE:31389 EMAGE:31389 EMAGE:31389 EMAGE:31389 EMAGE:31389
euxassay_016203_16 euxassay_016203_17 euxassay_016203_18 euxassay_016203_19 euxassay_016203_20
EMAGE:31389 EMAGE:31389 EMAGE:31389
euxassay_016203_21 euxassay_016203_22 euxassay_016203_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: one star
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 05 06 19
midbrain mantle layer
weak weak
regionalweak expression: see section 08 09 18 19
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45312
Entity Detected:Bnc2, ( MGI:2443805)
Sequence:sense strand is shown

>T45312
TGTACAGCCAGTTCCTCCTTTTTATAGAAGTTTACTTACTCCAGGGGAAATGGTGAGTCCTCCAACCTCC
CTCCCAACCAGTCCCATCATTCCGACCAGTGGCACCATAGAACAGCACCCTCCTCCACCCTCTGAGCCAA
TAGTGCCGGCAGTGATGATGGGCACTCATGAGCCCAGCGCTGACCTGGCACCTAAGAAAAAGCCTAGGAA
GTCAAGCATGCCTGTAAAAATTGAGAAGGAAATCATCGACACTGCCGACGAGTTTGACGATGAAGACGAC
GATCCTAATGACGGCGGGACCGTGGTCAATGACATGAGCCATGACAATCACTGTCATTCCCAAGATGAGA
TGAGCCCAGGCATGTCCGTGAAGGACTTCTCTAAGCATAACAGGACCCGGTGCATTTCAAGAACTGAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 225384225384. Forward Primer - name:225384_F_exon_Bnc2, sequence:TGTACAGCCAGTTCCTCCTTTT; Reverse Primer - name:225384_N_SP6_exon_Bnc2, sequence:TTCAGTTCTTGAAATGCACCG.The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EurExpress:euxassay_016203 same experiment
 EMAGE:29260 same embryo
 EMAGE:29500 same embryo
 EMAGE:29502 same embryo
 EMAGE:29501 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS